Медицинский колледж №2

Мутность сыворотки обусловлена избытком холестерина


БИОХИМИЯ И ПАТОХИМИЯ ЛИПИДОВ. КВАЛИФИКАЦИОННЫЕ ТЕСТЫ С ОТВЕТАМИ

 

содержание      ..     25      26      27      28     ..

 

 

БИОХИМИЯ И ПАТОХИМИЯ ЛИПИДОВ. КВАЛИФИКАЦИОННЫЕ ТЕСТЫ С ОТВЕТАМИ

 

6.265.      К липидам относятся:

А.  холестерин

Б.  триглицериды

В.  фосфолипиды

Г.  жирные кислоты

Д.  все перечисленные

 

6.266.      В организме человека липиды выполняют функцию:

А.  структурную

Б.  энергетическую

В.  защитную

Г.  предшественников биологически активных веществ

Д.  все перечисленное

 

6.267.      Биологическая роль ненасыщенных жирных кислот:

А.  предшественники простагландинов

Б.  транспортная функция

В.  участие в поддержании кислотно-основного равновесия

Г.  липотропная функция

Д.  иммунный ответ

 

6.268.      Всасывание липидов происходит преимущественно:

А.  полости рта

Б.  желудке

В.  12-перстной кишке

Г.  тонкой кишке

Д.  толстой кишке

 

6.269.      Для резорбции триглицеридов в кишечнике решающее значение имеют:

А.  эмульгирование

Б.  гидролиз

В.  образование мицелл

Г.  желчевыделение

Д.  все перечисленное

 

6.270.      Простагландиды синтезируются из:

А.  триглицеридов

Б.  холестерина

В.  кетоновых тел

Г.  насыщенных жирных кислот

Д.  полиненасыщенных жирных кислот

 

6.271.      Биологическая роль простагландидов:

А.  воздействие на центральную нервную систему

Б.  регуляция клеточного метаболиза

В.  регуляция сосудистого тонуса

Г.  воздействие на сократительную мускулатуру

Д.  все перечисленное верно

 

 

6.272.      Биологическая роль триглицеридов:

А.  участие в синтезе фосфолипидов

Б.  энергетическая

В.  липотропная

Г.  транспортная

Д.  активация ферментов

 

6.273.      В гидролизе триглицеридов участвуют ферменты:

А.  липаза

Б.  холестеринэстераза

В.  фосфолипаза

Г.  альфа-амилаза

Д.  гистидаза

 

6.274.      Основной транспортной формой эндогенных триглицеридов являются:

А.  хиломикроны

Б.  ЛПНП

В.  ЛПОНП

Г.  ЛПВП

Д.  неэстерифицированные жирные кислоты

 

6.275.      Мутность сыворотки обусловлена избытком:

А.  холестерина

Б.  фосфолипидов

В.  триглицеридов

Г.  жирных кислот

Д.  простагландинов

 

6.276.      Биологическая роль холестерина:

А.  липотропная

Б.  предшественник иммуноглобулинов

В.  основа для синтеза  витаминов, стероидных гормонов

Г.  участие в поддержании кислотно-основного состояния

Д.  все перечисленное

 

6.277.      На уровень холестерина крови влияют:

А.  пол

Б.  возраст

В.  гормональный статус

Г.  характер питания

Д.  все перечисленное

 

6.278.      В гепатоцитах холестерин переводится в:

А.  желчные кислоты

Б.  билирубин

В.  глобин

Г.  гиалуроновую кислоту

Д.  фибриноген

 

 

 

 

6.279.      Эстерификация холестерина происходит главным образом в:

А.  печени

Б.  плазме крови

В. сосудистой стенки

Г.  надпочечниках

Д.  всех перечисленных местах

 

6.280.      При исследовании показателей липидного обмена соблюдать следующее:

А.  брать кровь натощак

Б.  пробы хранить только в виде гепаринизированной плазмы

В.  посуду обезжиривать и обезвоживать

Г.  перейти на диету без холестерина за 2-3 суток до взятия крови для исследования

Д.  применять антилипемическую терапию перед исследованием

 

6.281.      Состояния и заболевания, сопровождающиеся гипохолестеринемией:

А.  нефротический синдром

Б.  климакс

В.  тяжелая физическая работа

Г.  дефицит инсулина

Д.  феохромацитома

 

6.282.      К патологическим состояниям, сопровождающимся стеатореей, относятся все перечисленные, кроме:

А.  панкреатита

Б.  синдром мальабсорбции

В.  желчнокаменной болезни

Г.  гастрита

Д.  усиленной моторики кишечника

 

6.283.      Холестерин является предшественником:

А.  половых гормонов

Б.  витамин «Д»

В.  гормонов коры надпочечников

Г.  всех перечисленных веществ

Д.  ни одного из перечисленных веществ

 

6.284.      Азотсодержащие соединения, входящие в состав фосфолипидов:

А.  холин

Б.  сфингозин

В.  серин

Г.  все перечисленные вещества

Д.  ни одного из перечисленных веществ

 

6.285.      Гормон, принимающий участие в регуляции липидного обмена, является:

А.  адреналин

Б.  глюкокортикоиды

В.  инсулин

Г. соматотропин

Д.  все перечисленные гормоны

 

 

 

6.286.   Для типирования гиперлипопротеидемии достаточности исследовать в сыворотке крови:

А.  альфа-холестерин

Б.  общий холестерин

В.  спектр липопротеидов

Г.  липопротеиды низкой плотности

Д.  триглицериды

 

6.287.   К кетоновым телам относятся:

А.  ацетон

Б.  ацетоуксусная кислота

В.  бета-оксимаслянная кислота

Г.  все перечисленные вещества

Д.  ни одно из перечисленных веществ

 

6.288.      К гликолипидам относятся:

А.  цереброзиды

Б.  эфиры холестерина

В.  лецитины

Г.  сфингомиелины

Д.  кефалины

 

6.289.      Простагландины являются производными:

А.  арахидоновой кислоты

Б.  холестерина

В.  пальмитиновой кислоты

Г.  стеариновой кислоты

Д.  олеиновой кислоты

 

6.290.      Содержание аполипопротеидов часто меняется при:

А.  ишемической болезни сердца

Б.  сахарном диабете

В.  семейной гиперлипидемии

Г.  ожирении

Д.  всех перечисленных состояниях

 

6.291.      Гипертриглицеридемия характерна для:

А.  ожирения

Б.  алкоголизма

В.  сахарного диабета

Г.  наследственной гиперлипидемии

Д.  всех перечисленных заболеваний

 

6.292.      Биологическая роль фосфолипидов:

А.  структурная

Б.  участие в синтезе белка

В.  обеспечение барьерных свойств мембран

Г.  стабилизация липопротеидов

Д.  все перечисленное

 

6.293.      Транспортные формы для липидов:

А.  гормоны

Б.  апопротеины

В.  липопротеиды

Г.  жирные кислоты

Д.  гликозаминогликаны

 

6.294.      Липопротеиды по плотности делятся на:

А.  низкой плотности

Б.  очень низкой плотности

В.  высокой плотности

Г.  все перечисленное верно

Д.  все перечисленное неверно

 

6.295.      Липоидозу артериальной стенки способствует:

 А.  увеличение ЛПНП

Б.  увеличение ЛПОНП

В.  снижение ЛПВП

Г.  образование антител против липопротеидов

Д.  все перечисленное

 

6.296.      В сыворотке крови после еды обнаруживают следующие классы липопротеидов:

А.  ЛПНП

Б.  ЛПВП

В.  ХМ

Г.  ЛПОНП

Д.  все перечисленные липопротеиды

 

6.297.      К факторам риска ишемической болезни сердца относятся:

А.  гиперхолестеринемия

Б.  диабет

В.  гипертония

Г.  курение

Д.  все перечисленные факторы

 

6.298.      Регулирующее действие на обмен липидов оказывают:

А.  эстрогены

Б.  соматотропный гормон гипофиза

В.  инсулин

Г.  адреналин

Д.  все перечисленные гормоны

 

6.299.      Ишемическая болезнь сердца чаще встречается при гиперлипопротеидемии типа:

А.  I

Б.  II

В.  IV

Г.  V

Д.  тип гиперлипидемии не влияет

 

6.300.      Активность липопротеиновой липазы снижена при типах гиперлипидемии:

А.  I

Б.  II Б

В.  III

Г.  IY

Д.  во всех перечисленных случаях

 

6.301.      Снижение фракции эстерифицированного холестерина отмечается при:

А.  циррозах печени

Б.  гипертонической болезни

В.  тиреотоксикозе

Г.  атеросклерозе

Д.  нефротическом синдроме

 

6.302.      Жировой гепатоз развивается при:

А.  алкоголизме

Б.  диабете

В.  ожирении

Г.  тиреотоксикозе

Д. во всех перечисленных случаях

 

6.303.      Свободные жирные кислоты в крови увеличиваются при:

А.  введении инсулина

Б.  сахарном диабете

В.  атеросклерозе

Г.  ишемической болезни сердца

Д.  всех перечисленных заболеваниях

 

6.304.      Уровень триглицеридов в сыворотке крови может повышаться при:

А.  лейкозах

Б.  сахарном диабете

В.  гепатитах

Г.  тиреотоксикозе

Д.  голодании

 

6.305.      Уровень холестерина в сыворотке крови может быть повышен при:

А.  циррозах печени

Б.  обтурационной желтухе

В.  повышенной продукции эстрогенов

Г.  гипертиреоидизме

Д.  во всех перечисленных случаях

 

6.306.      Обмен липидов нарушается при:

А.  диабете

Б.  гипотиреозе

В.  нефротическом синдроме

Г.  панкреатите

Д.  всех перечисленных заболеваниях

 

6.307.      Атерогенным эффектом обладают:

А.  альфа-липопротеиды

Б.  бета-липопротеиды

В.  фосфолипиды

Г.  полиненасыщенные жирные кислоты

Д.  ЛПВП

 

6.308.      Антиатерогенным эффектом обладают:

А.  триглицериды

Б.  холестерин

В.  пре-бета-липопротеиды

Г.  бета-липопротеиды

Д.  альфа-липопротеиды

 

6.309.      Липурия может быть при:

А.  переломе трубчатых костей с размножением костного мозга

Б.  травме обширных площадей жировой ткани

В.  наследственной гиперлипидемии

Г.  липоидном нефрозе

Д.  всех перечисленных заболеваниях

 

6.310.      Ферментный метод определения холестерина основан на действии:

А.  ЛХАТ, переводящей свободный холестерин в эфиры холестерина

Б.  холестериноксидазы с образованием холестерина и Н2О2

В.  липопротеидлипазы

Г.  фосфолипазы

Д.  всех перечисленных ферментов

 

6.311.      Увеличение холестерина в сыворотке крови у детей возможно при:

А.  врожденной атрезии желчных путей

Б.  начальной фазе острого гепатита

В.  билиарном постнекротическом циррозе

Г. неосложненной форме обтурационной желтухи

Д.  все перечисленное верно

 

6.312.      Аполипопротеином является белок, который:

А.  формирует белок-липидный комплекс

Б.  определяет функциональные свойства белок-липидного комплекса

В.  вызывает гиперлипопротеинемию при генетическом дефекте или отсутствии синтеза апобелка

Г.  в сыворотке входит в состав липопротеидов

Д.  все перечисленное верно

 

6.313.      Апо-А-белок входит в состав:

А.  хиломикронов

Б.  липопротеинов очень низкой плотности

В.  липопротеинов промежуточной плотности

Г.  липопротеинов низкой плотности

Д.  липопротеинов высокой плотности

 

6.314.      Апо-В-белок не входит в состав:

А.  липопротеинов очень низкой плотности

Б.  липопротеинов промежуточной плотности

В.  липопротеинов низкой плотности

Г.  липопротеинов высокой плотности

Д.  входит в состав всех перечисленных липопротеинов

 

6.315.      Фосфолипиды в сыворотке повышены при:

А.  беременности

Б.  гиперлипопротеидемии II типа

В.  алкогольном и билиарном циррозе печени

Г.  сахарном диабете

Д.  все перечисленное верно

 

6.316.      Больной 40 лет, плазма прозрачная, холестерин 5,2 ммоль/л,  ХС-ЛПВП  0,94 ммоль/л, индекс атерогенности 4,5 ед. Состояние липидного спектра можно расценить как:

А.  нормальный

Б.  гиперлипидемия

В.  гипохолестеринемия

Г.  спектр атерогенного характера

Д.  все перечисленное верно

 

6.317.      Женщина 50-ти лет с ожирением, плазма крови мутная, общий холестерин 6,5 ммоль/л, триглицериды – 3,0 ммоль/л, альфа-холестерин 1,5 ммоль/л. Можно предположить наличие гиперлипопротеидемии:

А.  I типа

Б.  II типа

В.  III типа

Г.  IV типа

Д.  V типа

 

6.318.      Мальчик 15 лет с ожирением, плазма хилезная, гипертриглицеридемия. Можно думать о гиперлипопротеидемии:

А.  I типа

Б.  II типа

В.  III типа

Г.  IV типа

Д.  V типа

 

6.319.      Больной 46 лет, поступил в клинику с жалобами на частые приступы стенокардии, возникающие в покое и при физической нагрузке. Приступы купировались нитроглицерином. Лабораторное исследование должно включать измерение в сыворотке крови:

А.  холестерина, альфа-холестерина, триглицеридов

Б.  холестерина, эфиров холестерина, общих липидов

В.  холестерина, общих липидов, фосфолипидов

Г.  холестерина, кетоновых тел, неэстерифицированных жирных кислот

Д.  любой план равнозначен

 

6.320.      Плазма при выдерживании в холодильнике равномерно мутная, холестерин 7,3 ммоль/л, триглицериды 3,7 ммоль/л. Электрофорез липопротеидов – широкая полоса в области ЛПНП и ЛПОНП. Тип гиперлипопротеидемии:

А.  II А

Б.  II Б

В.  III

Г.  IV

Д.  V

6.321.      Для исключения I и II типов гиперлипопротеидемии в исследуемой сыворотке крови достаточно:

А.  определить в ней липопротеиды

Б.  исследовать содержание холестерина и индекс атерогенности

В. обработать MnСl2, отцентрифугировать и в надосадочной жидкости определить холестерин

Г.  обнаружить сливообразный отстой после хранения сыворотки в холодильнике 16 часов

Д.  провести все перечисленные операции

 

6.322.      При уровне в крови холестерина 5,0 ммоль/л, a-холестерина 1,83 ммоль/л, триглицеридов 1,25 ммоль/л, индекс атерогенности 1,56. Вероятность развития ишемической болезни сердца:

А.  очень высокая

Б.  высокая

В.  умеренная

Г.  малая

Д.  оценить невозможно

 

6.323.      Для регулирования процесса перекисного окисления липидов используются:

А.  антидепрессанты

Б.  антиоксиданты

В.  антагонисты кальция

Г.  антибиотики

Д. все перечисленные препараты

 

 

 

 

ОТВЕТЫ - РАЗДЕЛ 6. КЛИНИЧЕСКАЯ БИОХИМИЯ

 

6.1. -В             6.31. -Б           6.61. -А           6.91. -Г           6.121. -А         6.151. -Д         6.181. -А         6.211. -Б

6.2. -Д             6.32. -Г           6.62. -Б           6.92. -Б           6.122. -Д         6.152. Б           6.182. -Д         6.212. -Д

6.3. -Д             6.33. -Д           6.63. -Б           6.93. -Д           6.123. -Г         6.153. -В         6.183. -В         6.213. -Д

6.4. -Б             6.34. -Д           6.64. -А           6.94. -Г           6.124. -А         6.154. -Г         6.184. -Г         6.214. -В

6.5. -В             6.35. -Д           6.65. -Г           6.95. -В           6.125. -Г         6.155. -А         6.185. -Б         6.215. -Д

6.6. -В             6.36. -Д           6.66. -В           6.96. -Г           6.126. -В         6.156. -Г         6.186. -Г         6.216. -Д

6.7. -А             6.37. -А           6.67. -В           6.97. -Д           6.127. -Г         6.157. -Д         6.187. -В         6.217. -Б

6.8. -Д             6.38. -Д           6.68. -А           6.98. -Д           6.128. -Д         6.158. -Б         6.188. -Г         6.218. -Д

6 9. -Д             6.39. -В           6.69. -Г           6.99. -Б           6.129. -Г         6.159. -Б         6.189. -Г         6.219. -Б

6.10. -Г           6.40. -Д           6.70. -В           6.100. -Д         6.130. -В         6.160. -В         6.190. -Б         6.220. -Д

6.11. -Б           6.41. -А           6.71. -Б           6.101. -Г         6.131. -Б         6.161. -Д         6.191. -Б         6.221. -А

6.12. -В           6.42. -А           6.72. -Д           6.102. -А         6.132. -В         6.162. -Б         6.192. -Г         6.222. -Б

6.13. -Б           6.43. -Г           6.73. -А           6.103. -В         6.133.-А          6.163. -А         6.193. -Б         6.223. -Д

6.14. -А           6.44. -Д           6.74. -А           6.104. -Д         6.134. -А         6.164. -Д         6.194. -Г         6.224. -А

6.15. -В           6.45. -А           6.75. -В           6.105. -Б         6.135. -Г         6.165. -А         6.195. -Д         6.225. -Д

6.16. -А           6.46. -В           6.76. -Г           6.106. -Б         6.136. -Д         6.166. -В         6.196. -Д         6.226. -Г

6.17. -В           6.47. -А           6.77. -Б           6.107. -Д         6.137. -Г         6.167. -А         6.197. -Д         6.227. -Д

6.18. -Д           6.48. -Д           6.78. -Б           6.108. -В         6.138. -Д         6.168. -Г         6.198. -Г         6.228. -Д

6 19. -Д           6.49. -Г           6.79. -А           6.109. -В         6.139. -Б         6.169. -В         6.199. -Д         6.229. -Б

6.20. -Г           6.50. -В           6.80. -Д           6.110. -В         6.140. -Д         6.170. -Д         6.200. -А         6.230. -Г

6.21. -Д           6.51. -Д           6.81. -В           6.111. -А         6.141. -В         6.171. -А         6.201. -А         6.231. -Д

6.22. -Б           6.52. -А           6.82. -В           6.112. -Б         6.142. -А         6.172. -А         6.202. -А         6.232. -Г

6.23. -Г           6.53. -В           6.83. -В           6.113. -Г         6.143. -В         6.173. -Д         6.203. -А         6.233. -Б

6.24. -В           6.54. -А           6.84. -Б           6.114. -А         6.144. -Г         6.174. -Д         6.204. -А         6.234. -Б

6.25. -В           6.55. -Г           6.85. -А           6.115. -Б         6.145. -В         6.175. -Д         6.205. -Д         6.235. -Д

6.26. -А           6.56. -Г           6.86. -Г           6.116. -В         6.146. -Д         6.176. -В         6.206. -Д         6.236. -Г

6.27. -В           6.57. -В           6.87. -Д           6.117. -А         6.147. -Г         6.177. -Д         6.207. -Г         6.237. -В

6.28. -Г           6.58. -Б           6.88. -Д           6.118. -Д         6.148. -В         6.178. -А         6.208. -Д         6.238. -В

6.29. -В           6.59. -В           6.89. -А           6.119. -В         6.149. -А         6.179. -Д         6.209. -Г         6.239. -Д

6.30. -Б           6.60. -  Г          6.90. -Б           6.120. -Г         6.150. -Г         6.180. -Г         6.210. -Г         6.240. -В

 

6.241. -Г         6.299. -Б         6.357. -Д         6.415. -Д         6.473. -В         6.531. -А         6.589. -Б         6.646. -В

6.242. -В         6.300. -А         6.358. -Д         6.416. -Г         6.474. -А         6.532. -Г         6.590. -В         6.647. -В

6.243. -В         6.301. -А         6.359. -А         6.417. -Г         6.475. -Б         6.533. -Д         6.591. -В         6.648. -Д

6.244. -В         6.302. -Д         6.360. -Д         6.418. -В         6.476. -Б         6.534. -А         6.592. -Г         6.649. -Г

6.245. -Б         6.303. -Б         6.361. -Б         6.419. -Д         6.477. -А         6.535. -Д         6.593. -А         6.650. -Б

6.246. -Д         6.304. -Б         6.362. -Д         6.420. -Г         6.478. -Д         6.536. -Д         6.594. -Г         6.651. -А

6.247. -Г         6.305. -Б         6.363. -А         6.421. -Б         6.479. -Д         6.537. -А         6.595. -А         6.652. -Б

6.248. -В         6.306. -Д         6.364. -Д         6.422. -А         6.480. -Д         6.538. -А         6.596. -Г         6.653. -Г

6.249. -А         6.307. -Б         6.365. -А         6.423. -В         6.481. -Д         6.539. -А         6.597. -Д         6.654. -Д

6.250. -Г         6.308. -Д         6.366. -Г         6.424. -Д         6.482. -Г         6.540. -А         6.598. -А         6.655. -А

6.251. -Б         6.309. -Д         6.367. -А         6.425. -Б         6.483. -Д         6.541. -А         6.599. -Б         6.656. -Д

6.252. -Д         6.310. -Б         6.368. -В         6.426. -Д         6.484. -В         6.542. -А         6.600. -Д         6.657. -А

6.253. -Б         6.311. -Д         6.369. -Д         6.427. -Д         6.485. -В         6.543. -Д         6.601. -Д         6.658. -Д

6.254. -Д         6.312. -Д         6.370. -Д         6.428. -А         6.486. -Д         6.544. -Д         6.602. -А         6.659. -А

6.255. -А         6.313. -Д         6.371. -Б         6.429. -Б         6.487. -А         6.545. -Б         6.603. -В         6.660. -А

6.256. -Д         6.314. -Г         6.372. -В         6.430. -Д         6.488. -Б         6.546. -Б         6.604. -Б         6.661. -В

6.257. -Д         6.315. -Д         6.373. -Б         6.431. -Б         6.489. -В         6.547. -Г         6.605. -А         6.662. -Д

6.258. -В         6.316. -А         6.374. -Б         6.432. -В         6.490. -Б         6.548. -Б         6.606. -Б         6.663. -В

6.259. -А         6.317. -Г         6.375. -Д         6.433. -А         6.491. -Д         6.549. -Д         6.607. -Д         6.664. -В

6.260. -Д         6.318. -А         6.376. -Г         6.434. -Б         6.492. -А         6.550. -Д         6.608. -В         6.665. -Г

6.261. -Г         6.319. -А         6.377. -А         6.435. -В         6.493. -Г         6.551. -В         6.609. -Д         6.666. -Г

6.262. -Б         6.320. -В         6.378. -Б         6.436. -В         6.494. -Г         6.552. -В         6.610. -А         6.667. -В

6.263. -Д         6.321. -Г         6.379. -Д         6.437. -Г         6.495. -Г         6.553. -Б         6.611. -А         6.668. -Д

6.264. -В         6.322. -Г         6.380. -А         6.438. -Б         6.496. -В         6.554. -В         6.612. -Б         6.669. -В

6.265. -Д         6.323. -Б         6.381. -А         6.439. -В         6.497. -В         6.555. -Д         6.613. -Б         6.670. -А

6.266. -Д         6.324. -А         6.382. -Г         6.440. -В         6.498. -В         6.556. -Д         6.614. -Б         6.671. -Б

6.267. -А         6.325. -В         6.383. -В         6.441. -А         6.499. -Д         6.557. -В         6.615. -Г         6.672. -А

6.268. -Г         6.326. -Д         6.384. -Д         6.442. -В         6.500. -Д         6.558. -Г         6.616. -Б         6.673. -Г

6.269. -Д         6.327. -Б         6.385. -Д         6.443. -В         6.501. -Г         6.559. -Г         6.617. -Д         6.674. -А

6.270. -Д         6.328. -Г         6.386. -Г         6.444. -В         6.502. -А         6.560. -Д         6.618. -А         6.675. -Б

6.271. -Д         6.329. -А         6.387. -Д         6.445. -Д         6.503. -А         6.561. -Г         6.619. -Б         6.676. -Б

6.272. -Б         6.330. -Г         6.388. -В         6.446. -Б         6.504. -Б         6.562. -В         6.620. -Д         6.677. -Г

6.273. -А         6.331. -Г         6.389. -Д         6.447. -В         6.505. -Д         6.563. -В         6.621. -Г         6.678. -Б

6.274. -В         6.332. -Г         6.390. -Д         6.448. -В         6.506. -Д         6.564. -Д         6.622. -А         6.679. -Д

6.275. -В         6.333. -А         6.391. -Д         6.449. -В         6.507. -В         6.565. -Г         6.623. -Б         6.680. -Д

6.276. -В         6.334. -Д         6.392. -В         6.450. -Г         6.508. -В         6.566. -Д         6.624. -Г         6.681. -А

6.277. -Д         6.335. -Г         6.393. -Г         6.451. -Б         6.509. -А         6.567. -В         6.625. -А         6.682. -В

6.278. -А         6.336. -Д         6.394. -В         6.452. -Г         6.510. -А         6.568. -Д         6.626. -В         6.683. -Д

6.279. -А         6.337. -А         6.395. -Д         6.453. -Б         6.511. -А         6.569. -Д         6.627. -Д         6.684. -Г

6.280. -А         6.338. -Г         6.396. -Д         6.454. -Б         6.512. -Б         6.570. -Д         6.628. -Д         6.685. -Г

6.281. -В         6.339. -Д         6.397. -А         6.455. -А         6.513. -В         6.571. -Д         6.629. -В         6.686. -Д

6.282. -Г         6.340. -В         6.398. -Г         6.456. -А         6.514. -Б         6.572. -Д         6.630. -В         6.687. -Д

6.283. -Г         6.341. -Б         6.399. -Г         6.457. -Г         6.515. -Б         6.573. -Г         6.631. -А         6.688. -Г

6.284. -Г         6.342. -Б         6.400. -Д         6.458. -Д         6.516. -Д         6.574. -Б         6.632. -Б         6.689. -В

6.285. -Д         6.343. -А         6.401. -Г         6.459. -Б         6.517. -Г         6.575. -В         6.633. -Б         6.690. -Г

6.286. -В         6.344. -В         6.402. -Д         6.460. -Б         6.518. -Д         6.576. -Д         6.634. -Б         6.691. -Д

6.287. -Г         6.345. -Г         6.403. -Д         6.461. -Д         6.519. -А         6.577. -А         6.635. -Д         6.692. -В

6.288. -А         6.346. -В         6.404. -А         6.462. -Г         6.520. -А         6.578. -А         6.636. -А         6.693. -Г

6.289. -А         6.347. -Д         6.405. -Д         6.463. -Д         6.521. -Г         6.579. -Г         6.637. -Б         6.694. -Д

6.290. -Д         6.348. -В         6.406. -Б         6.464. -Д         6.522. -Б         6.580. -Д         6.638. -Д         6.695. -Д

6.291. -Д         6.349. -Д         6.407. -В         6.465. -В         6.523. -А         6.581. -Б         6.639. -Д         6.696. -А

6.292. -Д         6.350. -В         6.408. -В         6.466. -Б         6.524. -А         6.582. -Г         6.640. -Б         6.697. -В

6.293. -В         6.351. -Б         6.409. -А         6.467. -Г         6.525. -Б         6.583. -Д         6.641. -Д         6.698. -Г

6.294. -Г         6.352. -Д         6.410. -Д         6.468. -А         6.526. -Д         6.584. -Б         6.642. -Д         6.699. -В

6.295. -Д         6.353. -Д         6.411. -Д         6.469. -Д         6.527. -А         6.585. -Д         6.643. -В         6.700. -А

6.296. -Д         6.354. -А         6.412. -Д         6.470. -Г         6.528. -Д         6.586. -Д         6.644. -Г         6.701. -В

6.297. -Д         6.355. -А         6.413. -Д         6.471. -Д         6.529. -Г         6.587. -В         6.645. -Б         6.702. -Д

6.298. -Д         6.356. -Д         6.414. -А         6.472. -В         6.530. -А         6.588. -В

 

 

 

 

 

 

 

 

 

содержание      ..     25      26      27      28     ..

 

 

Хилез крови - что это? Причины, симптомы и лечение

Под термином хилез крови подразумевается не заболевание, а временное состояние, при котором в крови обнаруживается повышенное количество триглицеридов.

Последних в анализе крови быть не должно. Хилезная кровь встречается у всех людей независимо от возраста, половой принадлежности и рода занятий.

Триглицериды: что это?

Триглицериды – это производные 3-атомного спирта глицерина и высших жирных кислот. Они являются компонентами растительных масел. Триглицериды, как и холестерин, генераторы энергии для полноценной жизнедеятельности клеток.

Попадая в организм с продуктами питания, триглицериды приобретают новые формы: становятся глицеролом и жирными кислотами. В преобразованном виде они всасываются слизистой тонкого кишечника и транспортируются в органы.

Уровень триглицеридов в крови постоянно варьируется на протяжении суток. Их количество возрастает в несколько раз спустя полчаса после приема пищи – это слабый хилез. К исходному количеству триглицериды возвращаются лишь спустя 10 часов.

Триглицериды и жирные кислоты

Плазма крови в норме и при хилезе

Плазма – это жидкий компонент крови. Она содержит форменные элементы. Цвет плазмы – желтый, она прозрачна на вид. Цвет же хилезной сыворотки определить нельзя – он мутный, присутствуют белые примеси.

Почему кровь мутная или в простонародье – «жирная»?

Мутность обусловлена избытком триглицеридов в крови. После центрифугирования такая кровь становится белой и чрезмерно густой, своим видом она напоминает сметану.

Хилезная сыворотка не позволяет выделить из нее компоненты крови. Потому она не пригодна для исследования. Не пригодна она и для переливания.

Почему возникает хилез крови?

Причины хилеза крови в основном кроются в некорректной подготовке к забору крови. Употребление тяжелой пищи или спиртных напитков накануне сдачи анализа способствует появлению «жирной» крови.

Именно продукты питания провоцируют скачок уровня нейтральных жиров в крови вверх.

Хилезная сыворотка образовывается также из-за проблем с обменом веществ. Хилез определяется при сахарном диабете, гипотиреозе.

Жир в анализах крови обнаруживается при:

  • Заболеваниях почечного аппарата (почечной недостаточности, нефрозе),
  • Патологиях печени (циррозе, вирусном поражении),
  • Нарушениях жирового обмена наследственного характера,
  • Сбоях в работе лимфатической системы.

Если присутствует генетический фактор, то говорят о выраженном хилезе, когда уровень триглицеридов в крови превышен в несколько десятков раз.

Способствовать хилезу крови может ряд таких заболеваний:

  • Панкреатит (хроника и острая форма),
  • Синдром дауна,
  • Подагра,
  • Атеросклероз,
  • Анорексия (по невротическому типу),
  • Стенокардия,
  • Острая порфирия,
  • Гемофилия,
  • Тромбоз сосудов,
  • Гиперкальциемия невыясненного генеза,
  • Инфаркт миокарда.

Как проявляется хилез крови?

Хилез может сопровождаться клиникой схожей с симптомами при ожирении, проблемами с печенью.

У пациента наблюдается:

  • Сонливость,
  • Повышенное выделение пота,
  • Отечность,
  • Слабость,
  • Боль в позвоночнике и суставах,
  • Запоры.

Чаще люди, у которых был обнаружен хилез, никаких изменений в состоянии здоровья не замечают.

Нужно ли лечение при хилезе крови?

Как и любому отклонению от нормы, хилезу необходима квалифицированная медицинская оценка. Лечение назначается после выявление причин, повлиявших на возникновение хилезной крови.

При данном состоянии врачи выписывают:

  • Лекарственные препараты,
  • Специальную диету,
  • Народные средства.

Лекарства подбираются каждому пациенту в индивидуальном порядке. Применяются медикаментозные средства, цель которых нормализация и улучшение деятельности печени и обменных процессов.

Лечение хилеза диетой

Диета при хилезе – первое, что необходимо пациентам с таким результатом анализов. Она должна снизить вязкость крови и улучшить ее циркуляцию. Список продуктов, которые стоит включить в свой рацион, а от которых нужно отказаться в обязательном порядке, представлен в таблице.

Полезные продукты при хилезе Стоп-продукты
Фрукты (лимон, апельсин, гранаты) Мучные и сладкие изделия (пирожные, торты, пироги)
Помидоры Колбасы
Льняное масло Соленья
Ягоды (смородина, калина, клюква) Жареная пища, соусы
Рыбий жир и морепродукты Яйца
Орехи (грецкие, миндаль, кешью) Алкоголь
Шпинат, брокколи, зелень Жирная молочная продукция

Под запретом остается использование острых приправ: красного перца, васаби, имбиря, табаско, горчицы.

Для приготовления блюд можно применять менее «жгучие» специи:

  • Тимьян,
  • Орегано,
  • Мяту,
  • Корицу.

Чтобы кровь стала менее густой, рекомендуется употреблять больше жидкости. Это может быть минеральная вода без газа либо обычная вода, в которую добавляется лимонный сок в небольшом количестве.

Разрешается пить натуральные соки на основе фруктов и овощей, зеленый чай, компоты.

Народная медицина «работает» при хилезе крови?

Рецепты народной медицины нередко помогают при повышенной вязкости крови, которая характерна для хилеза.

С этой целью наиболее часто используют отвары и настойки из таких растений и ягод:

  • Смородины,
  • Клюквы,
  • Чеснока,
  • Малины,
  • Облепихи.

Простые и доступные рецепты при хилезе крови:

  • Отвар из листьев смородины. Помимо листьев смородины (5-10 штук), понадобиться мед (1 ч. л), мята (5 веточек), вода (1 л). Растительные ингредиенты хорошо промываются под проточной водой и укладываются в термос или в чайник. Зелень заливается кипятком. Отвар заваривается в течение 2 часов, затем в него можно добавить мед.
  • Настой из чеснока и укропа. Очищенный чеснок (1 зубчик), укроп (1 пучок) укладывается в 0,5 л банку и заливается водкой (0,5 л). Настаивают жидкость в течение 4 дней в темном прохладном месте. Содержимое тщательно процеживается. Настой готов к употреблению.

Советы для тех, кто сдает кровь

Анализ крови будет достоверным, если перед исследованием придерживаться нескольких правил:

  • Нельзя есть (под запретом даже легкий завтрак),
  • Запрещено купить и принимать любой вид алкогольных напитков,
  • Принимать лекарства (противозачаточные таблетки, мочегонные препараты).

Если хилез при сдаче крови был выявлен впервые, то можно предположить, что его появлению способствовало несоблюдение диеты. Поэтому, чтобы добиться верных результатов при исследовании, рекомендуется выполнить все предписания врача по подготовке к процедуре. Если повторная сдача крови также выявит хилез, то следует обратиться за помощью к терапевту для определения причин и решения проблемы.

Видео: Что такое триглицериды? Для чего их определяют?

Загрузка...

Макроглобулинемия Вальденстрема

⇐ ПредыдущаяСтр 23 из 25Следующая ⇒

множественная миелома

хронический лимфолейкоз

хронический миелолейкоз

 

У пожилого пациента с артериальной гипертензией, эритроцитозом, лейкоцитозом, тромбоцитоцитозом, низкой СОЭ, тромбогеморрагическим синдромом наиболее вероятный диагноз:

болезнь Иценко-Кушинга

Полицитемия

острый эритромиелоз

почечно-клеточная карцинома

 

У пожилого пациента с анемией, высокой СОЭ, М-градиентом, нефропатией, костной деструкцией и высоким содержанием плазматических клеток в костном мозге наиболее вероятен диагноз:

гипопластическая анемия

макроглобулинемия Вальденстрема

Множественная миелома

хронический лимфолейкоз

хронический миелолейкоз

 

У 65-летней больной сахарным диабетом 2 типа в течение последних двух лет величина гликированного гемоглобина 5,0-6,0%, что означает:

Низкий риск развития макро- и микроангиопатии

повышенный риске развития макроангиопатии

повышенный риске развития микроангиопатии

 

ЛАБОРАТОРНАЯ ДИАГНОСТИКА

 

При взятии крови активность ферментов может меняться в результате:

продолжительного венозного стаза

травматизации

микрогемолиза эритроцитов

активации системы гемостаза

Всего перечисленного

 

Указать орган с наибольшим содержанием изоферментов ЛДГ-1 и ЛДГ-2:

Сердце

скелетные мышцы

печень

почки

 

Указать орган с наибольшим процентным содержанием изоферментов ЛДГ-4 и ЛДГ-5:

почки

Скелетные мышцы

легкие

сердце

 

Повышение активности аминотрансфераз отсутствует в случае:

вирусного гепатита

инфаркта миокарда

миодистрофии

Гломерулонефрита

панкреатита

 

При инфаркте миокарда повышается преимущественно сывороточная активность:

холинэстеразы

альфа-амилазы

Креатинфосфокиназы

 

Специфическим для инфаркта миокарда является повышение в сыворотке изофермента креатинфосфокиназы (КФК):

ММ-КФК

МВ-КФК

ВВ-КФК

всех перечисленных изоферментов

 

У больного с острым приступом болей за грудиной или в эпигастрии повышение сывороточной активности типа КФК>АСТ>АЛТ>амилазы наиболее вероятно для:

острого панкреатита

острого вирусного гепатита

почечной колики

Инфаркта миокарда

 

У больного с острым приступом болей за грудиной или в животе повышение активности амилазы >АЛТ >КФК наиболее вероятно для:

Острого панкреатита

острого вирусного гепатита

почечной колики

инфаркта миокарда

 

К липидам относятся:

холестерины (ХС)

триглицериды (ТГ)

фосфолипиды (ФЛ)

жирные кислоты (ЖК)

Все перечисленное

 

В организме человека липиды выполняют функцию:

структурную

энергетическую

защитную

предшественников биологически активных веществ

Все перечисленные

 

Активность липопротеиновой липазы снижена при типах гиперлипидемий:

I

II

III

IV

 

Ишемическая болезни сердца чаще встречается при гиперлипидемии типа:

I

II

IV

V

 

Биологическая роль холестерина:

липотропная

предшественник иммуноглобулинов

Основа синтеза витаминов и стероидных гормонов

 

На уровень холестерина крови влияют:

пол и возраст

гормональный статус

характер питания

Все перечисленное

 

Системы, участвующие в выделении холестерина из организма:

Печень

слюнные железы

почки

кожа

 

Состояние, сопровождающееся гипохолестеринемией:

нефротический синдром

климакс

Тяжелая физическая работа

дефицит инсулина

 

Биологическая роль триглицеридов:

регуляторная

Энергетическая

липотропная

активация ферментов

 

Мутность сыворотки обусловлена избытком:

фосфолипидов

Триглицеридов

простагландинов

 

Гипертриглицеридемия характерна для:

ожирения

алкоголизма

сахарного диабета

наследственной гиперлипидемии

Всего перечисленного

 

Уровень триглицеридов повышается при:

лейкозах

Сахарном диабете

гепатитах

 

Биологическая роль ненасыщенных жирных кислот:

Предшественники простагландинов

транспортная функция

участие в поддержании кислотно-основного состояния

 

Атерогенным эффектом обладают:

липопротеиды высокой плотности

Липопротеиды низкой плотности

фосфолипиды

 

Антиатерогенным эффектом обладают:

триглицериды

липопротеиды низкой плотности

Липопротеиды высокой плотности

 

Для регулирования процесса перекисного окисления липидов используются:

антидепрессанты

Антиоксиданты

антагонисты кальция

 

Показанием для плазмафереза у больных атеросклерозом является:

Наследственная гиперхолестеринемия

гиперальфа-липопротеидемия

гиперхиломикронемия

 

Биологическая роль фосфолипидов:

структурная

транспортная

липотропная

стабилизация липопротеидов

Все перечисленное

 

К гликопептидам относятся:

Цереброзиды

эфиры холестерина

лецитины

сфингомиелины

кефалины

 

Индекс (коэффициент) атерогенности вычисляется по формуле:

Общий ХС / ХС-ЛПВП

общий ХС / ХС-ЛПНП

общий ХС / триглицериды

 

Простагландины являются производными:

Арахидоновой кислоты

пальмитиновой кислоты

стеариновой кислоты

олеиновой кислоты

 

Биологическая роль простагландинов:

воздействие на ЦНС

регуляция клеточного метаболизма

регуляция сосудстого тонуса

воздействие на сократительную мускулатуру

Все верно

 

Кетоновые тела это:

ацетон

ацетоуксусная кислота

бета-оксимаслянная кислота

Все перечисленные вещества

 

Углеводы в организме выполняют следующие функции, кроме:

энергетической

структурной

Транспортной

пластической

субстрата для синтеза гликозоаминогликанов

 

Углеводы всасываются в виде:

крахмала

клетчатки

олигосахаридов

Моносахаридов

полисахаридов

 

Глюкозу в крови можно определить:

глюкозооксидантным методом

ортотолуидиновым методом

методом Хагедорна-Йенсена

гексокиназным методом

Всеми перечисленными методами

 

Глюкозу в моче можно определить:

поляриметрией

ортотолуидиновым методом

используя тест-полоски

методом Альтгаузена

Всеми перечисленными методами

 

Основным органом, участвующем в гомеостазе глюкозы, является:

кишечник

скелетные мышцы

Печень

надпочечники

почки

 

Депонированной формой углеводов является:

глюкозо-6-фосфат

Гликоген

олигосахариды

глюкозо-1-фосфат

пируват

 

Гипогликемическим эффектом обладает:

адреналин

кортизол

Инсулин

соматотропный гормон

 

Гипергликемическим эффектом обладает:

инсулин

паратиреоидный гормон

Глюкагон

прогестерон

 

Перемещение воды в организме осуществляется:

осмотическим давлением

онкотическим давлением

гидростатическим давлением

проницаемостью сосудистой стенки

Всеми перечисленными факторами

 

Основными катионами и анионами внеклеточного пространства являются:

натрий

хлор

кальций

бикарбонат

Все перечисленные ионы

 

Дегидратация развивается в результате:

потери солей при нормальном потреблении жидкостей

снижения концентрации глюкозы в сыворотке крови

Водного истощения

снижения концентрации белков в сыворотке крови

 

Гормонами, регулирующими вводно-электролитный обмен, являются:

альдостерон

вазопрессин

натрийуретический пептид

Все перечисленные

 

Влияние альдостерона на водно-солевой обмен осуществляется путем:

задержки воды в организме

увеличения почечной реабсорбции натрия

увеличения почечной экскреции калия

увеличения содержания натрия в клетках

Всех перечисленных механизмов

 

Влияние вазопрессина на водно-солевой обмен проявляется в виде:

Увеличения реабсорбции натрия и воды в почках

уменьшения осмолярности сыворотки крови

увеличения внеклеточной жидкости

все перечисленное верно

 

«Голодные отеки» обусловлены:

задержкой натрия в организме

Белковым истощением

увеличением альдостерона в сыворотке

гипергидратацией

 

Гипергидратация может наступить при указанных состояниях, кроме:

недостаточности кровообращения с венозным застоем

гиперсекрецией вазопрессина

Гиперальдостеронизма

водной интоксикации

 

Уровень натрия в крови регулируется:

Альдостероном

паратгормоном

кальцитонином

адреналином

 

Гипернатриемия отмечается при:

Синдроме Конна

болезни Аддисона

феохромоцитоме

 

Уровень кальция в крови регулирует гормон:

кальцитонин

кальцитриол

паратгормон

Все перечисленные

 

Основной путь выделения калия из организма:

с желчью

С мочой

с потом

 

Гипокалиемия может быть при:

Рвоте и поносе

почечной недостаточности (острой и хронической)

сепсисе

 

Гипохлоремия возникает при:

гиповентиляции

диабетическом кетоацидозе

хронической диарее

почечной недостаточности



Читайте также:

 

Липиды, биомембраны тест

Тема «ФУНКЦИИ И ОБМЕН ЛИПИДОВ. БИОЛОГИЧЕСКИЕ МЕМБРАНЫ»

на приведенные вопросы выберите ЕДИНСТВЕННЫЙ правильный ответ

Вариант 1

1. К липидам относятся:

А. холестерин

Б. триглицериды

В. фосфолипиды

Г. жирные кислоты

Д. все перечисленные

2. Простагландины синтезируются из:

А. триглицеридов

Б. холестерина

В. кетоновых тел

Г. насыщенных жирных кислот

Д. полиненасыщенных жирных кислот

3. Мутность сыворотки обусловлена избытком:

А. холестерина

Б. фосфолипидов

В. триглицеридов

Г. жирных кислот

Д. простагландинов

4. Холестерин является предшественником:

А. половых гормонов

Б. витамина Д

В. гормонов коры надпочечников

Г. всех перечисленных веществ

Д. ни одного из перечисленных веществ

5. Простагландины являются производными:

А. арахидоновой кислоты

Б. холестерина

В. пальмитиновой кислоты

Г. стеариновой кислоты

Д. олеиновой кислоты

6. Липоидозу артериальной стенки способствует:

А. увеличение ЛПНП

Б. увеличение ЛПОНП

В. снижение ЛПВП

Г. образование антител против липопротеидов

Д. все перечисленное

7. Аполипопротеином является белок, который:

А. формирует белок-липидный комплекс

Б. определяет функциональные свойства белок-липидного комплекса

В. вызывает гиперлипопротеинемию при генетическом дефекте или отсутствии синтеза апобелка

Г. в сыворотке входит в состав липопротеидов

Д. все перечисленное верно

8. Каким общим свойством обладают липиды?

А, Имеют четное число углеродных атомов

В. Гидролизуются панкреатическими липазами

С. Растворяются в неполярных органических растворителях

D. Вступают в реакции омыления

Е. Растворяются в воде.

9. На рисунке представлена формула, это:

А. Холевая кислота

В. Гликохолевая кислота

С. Таурохолевая кислота

D. Дезоксигликохолевая кислота

Е. Гликохенодозексихолевая кислота.

10. Увеличению количества триглицеридов в жировых клетках, угнетая процессы липолиза, способствует гормон:

А. Адреналин

В. Глюкагон

С. Тироксин

D. Кортизол

Е. Инсулин.

11.Какой фермент отщепляет двууглеродный радикал от бетта-кетоацил-КоА в процессе бетта-окисления жирных кислот?

А. Тиолаза

В. Ацилтрансфераза

С. Ацетил-КоА-дегидрогеназа

D. Ацил - КоА-дегидрогеназа

Е. Гидроксиацил - КоА- гидролиаза

12. Глицерол, возникший при распаде триацилглицеролов подвергается:

А. Восстановлению.

В, Окислению

С. Метилированию

D. Фосфорилированию

Е. Ацилированию

.

13. Свободные жирные кислоты образуются в результате действия на триацилглицеролы:

А. Фосфолипазы

В. Ацетилхолинэстеразы

С. Неспецифической эстеразы

D. Липазы

Е. ГМГ-редуктазы

.

14. Образование ацил-КоА катализирует:

А. Ацилтрансфераза

В. Ацил-КоА-синтетаза

С. Ацил - КоА-дегидрогеназа

D. Тиоэстераза

Е. Ацетил-КоА-ацилтрансфераза.

15. Каким образом происходит всасывание в кишечнике высших жирных кислот?

А. Свободное всасывание

В. В виде ЦДФ-производных

С. В виде эмульгированного жира

D. В виде мицелл

Е. В виде хиломикронов.

Тема «ФУНКЦИИ И ОБМЕН ЛИПИДОВ. БИОЛОГИЧЕСКИЕ МЕМБРАНЫ»

на приведенные вопросы выберите ЕДИНСТВЕННЫЙ правильный ответ

Вариант 2

1. В организме человека липиды выполняют функцию:

А. структурную

Б. энергетическую

В. защитную

Г. предшественников биологически активных веществ

Д. все перечисленное

2. Биологическая роль простагландидов:

А. воздействие на центральную нервную систему

Б. регуляция клеточного метаболиза

В. регуляция сосудистого тонуса

Г. воздействие на сократительную мускулатуру

Д. все перечисленное верно

3. Биологическая роль холестерина:

А. липотропная

Б. предшественник иммуноглобулинов

В. основа для синтеза витаминов, стероидных гормонов

Г. участие в поддержании кислотно-основного состояния

Д. все перечисленное

4. Азотсодержащие соединения, входящие в состав фосфолипидов:

А. холин

Б. этаноламин

В. серин

Г. все перечисленные вещества

Д. ни одного из перечисленных веществ

5. Гипертриглицеридемия характерна для:

А. ожирения

Б. алкоголизма

В. сахарного диабета

Г. наследственной гиперлипидемии

Д. всех перечисленных заболеваний

6. Активно синтезируются после еды следующие классы липопротеидов:

А. ЛПНП

Б. ЛПВП

В. ХМ

Г. все перечисленные липопротеиды

7. Для регулирования процесса перекисного окисления липидов используются:

А. антидепрессанты

Б. антиоксиданты

В. антагонисты кальция

Г. антибиотики

Д. все перечисленные препараты

8. Какие ткани используют кетоновые тела в качестве источника энергии при длительном голодании?

А. Мозг

В. Сердце

С. Скелетные мышцы

D. А и В

Е. А, В, С.

9. Какая реакция синтеза холестерина является ключевой?

А. Образование активного изопрена

В. Образование мевалоновой кислоты

С. Образование сквалена

D Образование ланостерина

Е. Образование 3-гидрокси-З-метилглутарил-КоА.

10. На рисунке представлена формула, это:

А. Глицерин

В. Глицероальдегид

С. Диоксиацетонфосфат

D. Глицерат

Е. Глицерол -3 -фосфат.

11. Какому веществу соответствует эта формула

R-CH2- CH(OH)-CH2-CO-S-KoA

А. Ацил-КоА

В. Еноил-КоА

С. бетта-гидроксиацил-КоА

D. бетта-кетоацил-КоА

Е. Ацилкарнитин.

12. В образовании лизофосфолипидов участвует:

А. Липаза

В. Фосфолипаза А1

С. Фосфолипаза А2

D. Фосфолипаза С

Е. Фосфолипаза D.

13. Какие из ниже перечисленных частиц носят название "антиатерогенных липопротеинов" и транспортируют холестерин из тканей в печень?

А. Мицеллы

В Хиломикроны

С, Липопротеины очень низкой плотности

D. Липопротеины высокий плотности

Е. Липопротеины низкой плотности.

14. Какое низкомолекулярное азотистое основание принимает участие в переносе остатка жирной кислоты через мембрану митохондрий?

А. Карнозин

В. Креатин

С. Креатинин

D. Анзерин

Е. Карнитин.

15. Распад высших жирных кислот преимущественно идет по пути:

А. Декарбоксилирования

В. Восстановления

С. бетта-окисления

D. альфа-окисления

Е. w-окисления.

Тема «ФУНКЦИИ И ОБМЕН ЛИПИДОВ. БИОЛОГИЧЕСКИЕ МЕМБРАНЫ»

на приведенные вопросы выберите ЕДИНСТВЕННЫЙ правильный ответ

Вариант 3

1. Биологическая роль ненасыщенных жирных кислот:

А. предшественники простагландинов

Б. транспортная функция

В. участие в поддержании кислотно-основного равновесия

Г. активируют липазу

Д. иммунный ответ

2. Биологическая роль триглицеридов:

А. участие в синтезе фосфолипидов

Б. энергетическая

В. липотропная

Г. транспортная

Д. активация ферментов

3. На уровень холестерина крови влияют:

А. пол

Б. возраст

В. гормональный статус

Г. характер питания

Д. все перечисленное

4. Гормон, принимающий участие в регуляции липидного обмена, является:

А. адреналин

Б. глюкокортикоиды

В. инсулин

Г. соматотропин

Д. все перечисленные гормоны

5. Биологическая роль фосфолипидов:

А. структурная

Б. участие в синтезе белка

В. обеспечение барьерных свойств мембран

Г. стабилизация липопротеидов

Д. все перечисленное

6. Регулирующее действие на обмен липидов оказывают:

А. эстрогены

Б. соматотропный гормон гипофиза

В. инсулин

Г. адреналин

Д. все перечисленные гормоны

7. Какая из приведенных жирных кислот не синтезируется в организме и должна поступать с пищей?

А. Пальмитиновая

В. Олеиновая

С. Стеариновая

D. Линолевая

Е. Лауриновая

.

8. Значительная часть холестерина плазмы крови этерифицирована жирными кислотами. В образовании эфиров холестерина принимает участие следующий фермент:

А. Ацетилтрансфераза

В. Метилтрансфераза

С. Ацилтрансфераза

D. Ацилсинтетаза

Е. Холестеролэстераза.

9. Какому соединению принадлежит эта формула?

А. Фосфатидилхолин

В. Фосфатидилэтаноламин

С. Фосфатидилсерин

D. Фосфохолин

Е. Фосфоэтаноламин.

10. Какие из ниже перечисленных частиц транспортируют в основном триглицериды из кишечника к периферическим тканям?

А. Мицеллы

В. Хиломикроны

С. Липопротеины очень низкой плотности

D. Липопротеины низкой плотности

Е. Липопротеины высокой плотности.

11. В какой части клетки идёт синтез высших жирных кислот?

А. Ядро

В. Митохондрии

С. Цитозоль

D. Лизосомы

Е. Рибосомы

12. К кетоновым (ацетоновым) телам относится:

А. Ацетоацетил-КоА

В. Ацетоацетат

С. Бутират

D. Сукцинат

Е. Ацетат.

13. Значительная часть холестерина плазмы крови этерифицирована жирными кислотами. В образовании эфиров холестерина принимает участие следующий фермент:

А. Ацетилтрансфераза

В. Метилтрансфераза

С. Ацилтрансфераза

D. Ацилсинтетаза

Е. Холестеролэстераза.

14. Из перечисленных высших жирных кислот назовите кислоту, содержащую в своей структуре чтыре ненасыщенные двойные связи:

А. Арахидоновая

В. Миристиновая

С. Лауриновая

D. Леноленовая

Е. Олеиновая.

15. Ключевой фермент, регулирующий синтез холестерина, катализирует превращение:

А. Ацетоацетил-КоА в бета-гидрокси-бета-метилглутарил-КоА

В. Диметилаллилпирофосфата в изопентилпирофосфат

С. Бета-окси-бета-метилглутарил-КоА в мевалоновую кислоту

D. Сквалена в холестерин

Е. Мевалоновой кислоты в пирофосфорный эфир мевалоновой кислоты.

Тема «ФУНКЦИИ И ОБМЕН ЛИПИДОВ. БИОЛОГИЧЕСКИЕ МЕМБРАНЫ»

на приведенные вопросы выберите ЕДИНСТВЕННЫЙ правильный ответ

Вариант 4

1. Всасывание липидов происходит преимущественно:

А. полости рта

Б. желудке

В. 12-перстной кишке

Г. тонкой кишке

Д. толстой кишке

2. В гидролизе триглицеридов участвуют ферменты:

А. липаза

Б. холестеринэстераза

В. фосфолипаза

Г. альфа-амилаза

Д. гистидаза

3. В гепатоцитах холестерин переводится в:

А. желчные кислоты

Б. билирубин

В. глобин

Г. гиалуроновую кислоту

Д. фибриноген

4. К кетоновым телам относятся:

А. ацетон

Б. ацетоуксусная кислота

В. бета-оксимаслянная кислота

Г. все перечисленные вещества

Д. ни одно из перечисленных веществ

5. Транспортные формы для липидов:

А. гормоны

Б. апопротеины

В. липопротеиды

Г. жирные кислоты

Д. гликозаминогликаны

6. Атерогенным эффектом обладают:

А. альфа-липопротеиды

Б. бета-липопротеиды

В. фосфолипиды

Г. полиненасыщенные жирные кислоты

Д. ЛПВП

7. Липопротеины переносят:

А. Глицериды

В. Фосфолипиды

С. Холестерин

D. Эфиры холестерина

Е. Все ответы правильные.

8. В основе структуры холестерина лежит:

А. Фенантрен

В. Пентофенантрен

С. Циклопентан

D. Циклопентанпергидрофенантрен

Е Циклопентанфенантрен.

9. Какому соединению соответствует эта формула?

А Таурохолевая кислота

В. Гликохолевая кислота

С. Тауродезоксихолевая кислота

D. Гликодезоксихолевая кислота

Е. Таурохенодезоксихолевая.

10. Какие из ниже перечисленных частиц носят название "атерогенных липопротеинов" и способствуют проникновению холестерина в ткани?

А. Мицеллы

В. Хиломикроны

С. Липопротеины низкой плотности

D. Липопротеины высокой плотности

Е. Все ответы правильны.

11. К кетоновым (ацетоновым) телам относится:

А. Ацетоацетил-КоА

В. Ацетоацетат

С. Бутират

D. Сукцинат

Е. Ацетат.

12. Какой фермент имеет наибольшее значение во внутриклеточном липолизе и является регуляторным ферментом?

А. Аденилатциклаза

В. Протеинкиназа

С. Триглицеридлипаза

D. Диглицеридлипаза

Е. Моноглицеридлипаза.

13. Какой нуклеозидтрифосфат участвует в синтезе фосфолипидов?

А. ГТФ

В. АТФ

С. УТФ

D. ЦТФ

Е. d-АТФ.

14. Определите биологическую роль данного динуклеотида?

А. Играет роль кофермента при биосинтезе жирных кислот и холестерина

В. Играет роль кофермента в синтезе кетоновых тел

С. Играет роль кофермента в реакциях бета-окисления

D. Участвует в тканевом дыхании

Е. Играет роль кофермента в анаэробном окислении глюкозы.

15. Из перечисленных высших жирных кислот назовите кислоту, содержащую в своей структуре три ненасыщенные двойные связи:

А. Арахидоновая

В. Миристиновая

С. Лауриновая

D. Леноленовая

Е. Олеиновая.

Тема «ФУНКЦИИ И ОБМЕН ЛИПИДОВ. БИОЛОГИЧЕСКИЕ МЕМБРАНЫ»

на приведенные вопросы выберите ЕДИНСТВЕННЫЙ правильный ответ

Вариант 5

1. Для резорбции триглицеридов в кишечнике решающее значение имеют:

А. эмульгирование

Б. гидролиз

В. образование мицелл

Г. желчевыделение

Д. все перечисленное

2. Основной транспортной формой эндогенных триглицеридов являются:

А. хиломикроны

Б. ЛПНП

В. ЛПОНП

Г. ЛПВП

Д. неэстерифицированные жирные кислоты

3. Эстерификация холестерина происходит главным образом в:

А. печени

Б. плазме крови

В. сосудистой стенки

Г. надпочечниках

Д. всех перечисленных местах

4. К гликолипидам относятся:

А. цереброзиды

Б. эфиры холестерина

В. лецитины

Г. сфингомиелины

Д. простагландины

5. Липопротеиды по плотности делятся на:

А. низкой плотности

Б. очень низкой плотности

В. высокой плотности

Г. все перечисленное верно

Д. все перечисленное неверно

6. Антиатерогенным эффектом обладают:

А. триглицериды

Б. холестерин

В. пре-бета-липопротеиды

Г. бета-липопротеиды

Д. альфа-липопротеиды

7. На рисунке представлена формула, это:

А. Цереброзид

В. Церамид

С. Сфингозин

D. Сфингомиелин

Е. Церазин.

8. Сколько молей АТФ фактически образуется за один цикл бетта-окисления 1 моля жирной кислоты?

А. 3 моля

В. 4 моля

С. 5 молей

D.6 молей

Е. 7 молей.

9. Какие биологически активные вещества в организме образуются лишь из арахидоновой кислоты?

А. Стериды

В. Фосфолипиды

С. Кетоновые тела

D. Простагландины

Е. Липопротеины.

10. Сколько молей ацетил-КоА образуется в результате, бетта-окисления 1 моля стеариновой кислоты?

А.6 молей

В. 7 молей

С. 8 молей

D. 9 молей

Е. 10 молей.

11. Мультиферментный комплекс, способный осуществлять весь цикл реакций биосинтеза пальмитиновой кислоты, называется:

А. Ацетил-КоА-карбоксилаза

В. Гидратаза высших жирных кислот

С. Ацилтрансфераза

D. Трансацилаза

Е. Синтетаза высших жирных кислот.

12. Ключевой фермент, регулирующий синтез холестерина, катализирует превращение:

А. Ацетоацетил-КоА в бета-гидрокси-бета-метилглутарил-КоА

В. Диметилаллилпирофосфата в изопентилпирофосфат

С. Бета-окси-бета-метилглутарил-КоА в мевалоновую кислоту

D. Сквалена в холестерин

Е. Мевалоновой кислоты в пирофосфорный эфир мевалоновой

кислоты.

13. Формула какого биологически активного соединения приведена?

А. Холановая кислота

В. Холестерин

С. Хенодезоксихолевая

D. Ланостерин

Е. Холевая кислота.

14. Какова биологическая роль липопротеинов в организме?

А. Являются резервными белками

В. Выполняют гидролиз липидов

С, Служат для транспорта липидов в организме

D. Являются источником энергии

Е. Являются аллостерическими ингибиторами

.

15. Назовите орган или ткань в организме взрослого человека, наиболее активно осуществляющий процесс утилизации бета-гидроксибутирата:

А. Печень

В. Сердце

С. Жировая ткань

D. Почки

Е. Все ответы правильны.

Тема «ФУНКЦИИ И ОБМЕН ЛИПИДОВ. БИОЛОГИЧЕСКИЕ МЕМБРАНЫ» (эталоны ответов)

Вариант

вопрос

1

2

3

4

5

1

Д

Д

А

Г

Д

2

Д

Д

Б

А

В

3

В

Д

Д

А

А

4

Г

Г

Д

Г

А

5

А

Д

Д

В

Г

6

Д

В

Д

Б

Д

7

Д

Б

Д

Е

Д

8

С

Е

Е

Д

С

9

В

В

В

А

Д

10

Е

Е

В

С

Д

11

А

С

С

В

Е

12

Д

С

В

С

С

13

Д

Д

Е

Д

А

14

В

Е

А

А

С

15

Д

С

С

Д

В

Персональный сайт - Тестовые задания по теме "Обмен липидов"

“Химия и обмен липидов”

1. Основной функцией липидов является:

А) энергетическая

Б) защитная

В) транспортная

Г) пластическая

2. При полном распаде 1 г жира выделяется энергии:

А) 8,3 ккал

Б) 9,3 ккал

В) 10,3 ккал

Г) 12,3 ккал

3. Мутность сыворотки обусловлена избытком:

А) холестерина

Б) фосфолипидов

В) ТАГ

Г) жирных кислот

4. К липидам относятся:

А) холестерин

Б) ТАГ

В) фосфолипиды

Г) все перечисленные

5. К ненасыщенным жирным кислотам относятся:

А) олеиновая

Б) линолевая

В) линоленовая

Г) все перечисленные

6. Основной транспортной формой ТАГ являются:

А) хиломикроны

Б) ЛПНП

В) ЛПВП

Г) все перечисленное

7. Эмульгаторами жиров в организме являются:

А) холин

Б) креатинин

В) желчные кислоты

Г) глицерин

8. Общие свойства липидов:

А) гидрофобность

Б) гидрофильность

В) амфотерность

Г) все перечисленное верно

9. Холестерин является предшественником:

А) стероидных гормонов

Б) витамина Д

В) желчных кислот

Г) всех перечисленных веществ

10. На уровень холестерина крови влияет

А) возраст

Б) гормональный статус

В) характер питания

Г) все перечисленное верно

11. Всасывание липидов происходит преимущественно в:

А) полости рта

Б) желудке

В) 12-ти перстной кишке

Г) тонкой кишке

12. Липопротеины состоят из:

А) белков и углеводов

Б) белков и липидов

В) глицерина и жирных кислот

Г) углеводов и липидов

13. Высокую активность липолитических ферментов в слизистой оболочке тонкого кишечника обеспечивает среда:

А) кислая

Б) слабощелочная

В) нейтральная

Г) сильнокислая

14. Для оценки состояния липидного обмена следует определить:

А) холестерин

Б) ТАГ

В) ЛПВП

Г) все перечисленное

15. Антиатерогенным эффектом обладают:

А) холестерин

Б) ЛПНП

В) ЛПВП

Г) ЛПОНП

16. Снижение ЛПВП характерно для:

А) больших регулярных физических нагрузок

Б) цирроза печени

В) ожирения

Г) алкоголизма

17. Желчные кислоты способствуют:

А) эмульгированию пищевых жиров

Б) активированию липазы

В) все перечисленное верно

Г) все перечисленное неверно

18. Для переваривания фосфолипидов в желудочно-кишечном тракте необходим фермент:

А) фосфолипаза

Б) декарбоксилаза

В) амилаза

Г) трансаминаза

19. К патологии липидного обмена относится:

А) гипербилирубинемия

Б) глюкозурия

В) гиперпротеинемия

Г) гиперлипемия

20. Подобрать соответствующий состав для липопротеинов высокой плотности:

А) 90 % ТАГ и 2% белков

Б) 50 % эфиры холестерина и холестерин

В) 50 % белка, 20 % эфиры холестерина и холестерин

Г) 10% белка и 50-55% ТАГ

21. Хиломикроны необходимы для транспорта липидов:

А) из стенки кишечника в лимфу и кровь

Б) из печени в кровь

В) из просвета кишечника в стенку кишечника

Г) от клеток тканей к клеткам печени

22. Лабораторные данные, используемые для установления типа первичных дислипопротеинемий (ДЛП):

А) содержание общего холестерина

Б) содержание ХС ЛПНП, ХС ЛПОНП

В) содержание ХС ЛПВП

Г) всех перечисленных

23. Подобрать соответствующий состав для хиломикронов:

А) 50% белка, 20% эфиры холестерина и холестерин

Б) 90% ТАГ и 2% белков

В) 50% эфиры холестерина и холестерин

Г) 10% белка и 50-55% ТАГ

24. Для переваривания ТАГ необходимы:

А) липаза

Б) эмульгаторы

В) слабощелочная среда

Г) все перечисленное верно

25. Транспорт липидов происходит за счет:

А) гормонов

Б) липопротеинов

В) жирных кислот

Г) фосфолипидов

26. К желчным кислотам относятся:

А) аспарагиновая

Б) холевая

В) глутаминовая

Г) жирная

27. После приема пищи образование хиломикронов

А) усиливается

Б) уменьшается

В) остается без изменения

Г) не происходит

28. Гиперхолестеринемия – это

А) содержание холестерина в крови

Б) повышенное содержание холестерина в крови

В) повышенное содержание в крови ЛПВП

Г) пониженное содержание в крови ЛПНП

КВАЛИФИКАЦИОННЫЕ ТЕСТЫ I УРОВНЯ ПО ВОПРОСАМ ПЕРВИЧНОЙ МЕДИЦИНСКОЙ ПОМОЩИ

 

содержание   ..  8  9  10 

 

 



 

1006.     При взятии крови активность ферментов может меняться в результате:

                       1 –      продолжительного венозного стаза

                       2 –      травматизации

                       3 –      микрогемолиза эритроцитов

                       4 –      активации системы гемостаза

                       5 –      всего перечисленного

 

1007.     Указать орган с наибольшим содержанием изоферментов ЛДГ-1 и ЛДГ-2:

                       1 –      сердце

                       2 –      скелетные мышцы

                       3 –      печень

                       4 –      почки

 

1008.     Указать орган с наибольшим процентным содержанием изоферментов ЛДГ-4 и ЛДГ-5:

                       1 –      почки

                       2 –      скелетные мышцы

                       3 –      легкие

                       4 –      сердце

 

1009.     Повышение активности аминотрансфераз отсутствует в случае:

                       1 –      вирусного гепатита

                       2 –      инфаркта миокарда

                       3 –      миодистрофии

                       4 –      гломерулонефрита

                       5 –      панкреатита

 

1010.     При инфаркте миокарда повышается преимущественно сывороточная активность:

                       1 –      холинэстеразы

                       2 –      альфа-амилазы

                       5 –      креатинфосфокиназы


 

1011.     Специфическим для инфаркта миокарда является повышение в сыворотке изофермента креатинфосфокиназы (КФК):

                       1 –      ММ-КФК

                       2 –      МВ-КФК

                       3 –      ВВ-КФК

                       4 –      всех перечисленных изоферментов

 

1012.     У больного с острым приступом болей за грудиной или в эпигастрии повышение сывороточной активности типа КФК>АСТ>АЛТ>амилазы наиболее  вероятно для:

                       1 –      острого панкреатита

                       2 –      острого вирусного гепатита

                       3 –      почечной колики

                       4 –      инфаркта миокарда

 

1013.     У больного  с острым приступом болей за грудиной или в животе повышение активности  амилазы >АЛТ >КФК наиболее вероятно для:

                       1 –      острого панкреатита

                       2 –      острого вирусного гепатита

                       3 –      почечной колики

                       4 –      инфаркта миокарда

 

1014.     К липидам относятся:

                       1 –      холестерины (ХС)

                       2 –      триглицериды (ТГ)

                       3 –      фосфолипиды (ФЛ)

                       4 –      жирные кислоты (ЖК)

                       5 –      все перечисленное

 

1015.     В организме человека липиды выполняют функцию:

                       1 –      структурную

                       2 –      энергетическую

                       3 –      защитную

                       4 –      предшественников биологически активных веществ

                       5 –      все перечисленные


 

1016.     Активность липопротеиновой липазы снижена при типах гиперлипидемий:

                       1 –      I

                       2 –      II

                       3 –      III

                       4 –      IV

 

1017.     Ишемическая болезни сердца чаще встречается при гиперлипидемии типа:

                       1 –      I

                       2 –      II

                       3 –      IV

                       4 –      V

 

1018.     Биологическая роль холестерина:

                       1 –      липотропная

                       2 –      предшественник иммуноглобулинов

                       3 –      основа синтеза витаминов и стероидных гормонов

 

1019.     На уровень холестерина крови влияют:

                       1 –      пол и возраст

                       2 –      гормональный статус

                       3 –      характер питания

                       4 –      все перечисленное

 

1020.     Системы, участвующие в выделении холестерина из организма:

                       1 –      печень

                       2 –      слюнные железы

                       3 –      почки

                       4 –      кожа

 

1021.     Состояние, сопровождающееся гипохолестеринемией:

                       1 –      нефротический синдром

                       2 –      климакс

                       3 –      тяжелая физическая работа

                       4 –      дефицит инсулина


 

1022.     Биологическая роль триглицеридов:

                       1 –      регуляторная

                       2 –      энергетическая

                       3 –      липотропная

                       4 –      активация ферментов

 

1023.     Мутность сыворотки обусловлена избытком:

                       1 –      фосфолипидов

                       2 –      триглицеридов

                       3 –      простагландинов

 

1024.     Гипертриглицеридемия характерна для:

                       1 –      ожирения

                       2 –      алкоголизма

                       3 –      сахарного диабета

                       4 –      наследственной гиперлипидемии

                       5 –      всего перечисленного

 

1025.     Уровень триглицеридов повышается при:

                       1 –      лейкозах

                       2 –      сахарном диабете

                       3 –      гепатитах

 

1026.     Биологическая роль ненасыщенных жирных кислот:

                       1 –      предшественники простагландинов

                       2 –      транспортная функция

                       3 –      участие в поддержании кислотно-основного состояния

 

1027.     Атерогенным эффектом обладают:

                       1 –      липопротеиды высокой плотности

                       2 –      липопротеиды низкой плотности

                       3 –      фосфолипиды

 

1028.     Антиатерогенным эффектом обладают:

                       1 –      триглицериды

                       2 –      липопротеиды низкой плотности

                       3 –      липопротеиды высокой плотности


 

1029.     Для регулирования процесса перекисного окисления липидов используются:

                       1 –      антидепрессанты

                       2 –      антиоксиданты

                       3 –      антагонисты кальция

 

1030.     Показанием для плазмафереза у больных атеросклерозом является:

                       1 –      наследственная гиперхолестеринемия

                       2 –      гиперальфа-липопротеидемия

                       3 –      гиперхиломикронемия

 

1031.     Биологическая роль фосфолипидов:

                       1 –      структурная

                       2 –      транспортная

                       3 –      липотропная

                       4 –      стабилизация липопротеидов

                       5 –      все перечисленное

 

1032.     К гликопептидам относятся:

                       1 –      цереброзиды

                       2 –      эфиры холестерина

                       3 –      лецитины

                       4 –      сфингомиелины

                       5 –      кефалины

 

1033.     Индекс (коэффициент) атерогенности вычисляется по формуле:

                       1 –      общий ХС / ХС-ЛПВП

                       2 –      общий ХС / ХС-ЛПНП

                       3 –      общий ХС / триглицериды

 

1034.     Простагландины являются производными:

                       1 –      арахидоновой кислоты

                       2 –      пальмитиновой кислоты

                       3 –      стеариновой кислоты

                       4 –      олеиновой кислоты

 

1035.     Биологическая роль простагландинов:

                       1 –      воздействие на ЦНС

                       2 –      регуляция клеточного метаболизма

                       3 –      регуляция сосудстого тонуса

                       4 –      воздействие на сократительную мускулатуру

                       5 –      все верно

 

1036.     Кетоновые тела это:

                       1 –      ацетон

                       2 –      ацетоуксусная кислота

                       3 –      бета-оксимаслянная кислота

                       4 –      все перечисленные вещества

 

1037.     Углеводы в организме выполняют следующие функции, кроме:

                       1 –      энергетической

                       2 –      структурной

                       3 –      транспортной

                       4 –      пластической

                       5 –      субстрата для синтеза гликозоаминогликанов

 

1038.     Углеводы всасываются в виде:

                       1 –      крахмала

                       2 –      клетчатки

                       3 –      олигосахаридов

                       4 –      моносахаридов

                       5 –      полисахаридов

 

1039.     Глюкозу в крови можно определить:

                       1 –      глюкозооксидантным методом

                       2 –      ортотолуидиновым методом

                       3 –      методом Хагедорна-Йенсена

                       4 –      гексокиназным методом

                       5 –      всеми перечисленными методами


 

1040.     Глюкозу в моче можно определить:

                       1 –      поляриметрией

                       2 –      ортотолуидиновым методом

                       3 –      используя тест-полоски

                       4 –      методом Альтгаузена

                       5 –      всеми перечисленными методами

 

1041.     Основным органом, участвующем в гомеостазе глюкозы, является:

                       1 –      кишечник

                       2 –      скелетные мышцы

                       3 –      печень

                       4 –      надпочечники

                       5 –      почки

 

1042.     Депонированной формой углеводов является:

                       1 –      глюкозо-6-фосфат

                       2 –      гликоген

                       3 –      олигосахариды

                       4 –      глюкозо-1-фосфат

                       5 –      пируват

 

1043.     Гипогликемическим эффектом обладает:

                       1 –      адреналин

                       2 –      кортизол

                       3 –      инсулин

                       4 –      соматотропный гормон

 

1044.     Гипергликемическим эффектом обладает:

                       1 –      инсулин

                       2 –      паратиреоидный гормон

                       3 –      глюкагон

                       4 –      прогестерон


 

1045.     Перемещение воды в организме осуществляется:

                       1 –      осмотическим давлением

                       2 –      онкотическим давлением

                       3 –      гидростатическим давлением

                       4 –      проницаемостью сосудистой стенки

                       5 –      всеми перечисленными факторами

 

1046.     Основными катионами и анионами внеклеточного пространства являются:

                       1 –      натрий

                       2 –      хлор

                       3 –      кальций

                       4 –      бикарбонат

                       5 –      все перечисленные ионы

 

1047.     Дегидратация развивается в результате:

                       1 –      потери солей при нормальном потреблении жидкостей

                       2 –      снижения концентрации глюкозы в сыворотке крови

                       3 –      водного истощения

                       4 –      снижения концентрации белков в сыворотке крови

 

1048.     Гормонами, регулирующими вводно-электролитный обмен, являются:

                       1 –      альдостерон

                       2 –      вазопрессин

                       3 –      натрийуретический пептид

                       4 –      все перечисленные

 

1049.     Влияние альдостерона на водно-солевой обмен осуществляется путем:

                       1 –      задержки воды в организме

                       2 –      увеличения почечной реабсорбции натрия

                       3 –      увеличения почечной экскреции калия

                       4 –      увеличения содержания натрия в клетках

                       5 –      всех перечисленных механизмов


 

1050.     Влияние вазопрессина на водно-солевой обмен проявляется в виде:

                       1 –      увеличения реабсорбции натрия и воды в почках

                       2 –      уменьшения осмолярности сыворотки крови

                       3 –      увеличения внеклеточной жидкости

                       4 –      все перечисленное верно

 

1051.     «Голодные отеки» обусловлены:

                       1 –      задержкой натрия в организме

                       2 –      белковым истощением

                       3 –      увеличением альдостерона в сыворотке

                       4 –      гипергидратацией

 

1052.     Гипергидратация может наступить при указанных состояниях, кроме:

                       1 –      недостаточности кровообращения с венозным застоем

                       2 –      гиперсекрецией вазопрессина

                       3 –      гиперальдостеронизма

                       4 –      водной интоксикации

 

1053.     Уровень натрия в крови регулируется:

                       1 –      альдостероном

                       2 –      паратгормоном

                       3 –      кальцитонином

                       4 –      адреналином

 

1054.     Гипернатриемия отмечается при:

                       1 –      синдроме Конна

                       2 –      болезни Аддисона

                       3 –      феохромоцитоме

 

1055.     Уровень кальция в крови регулирует гормон:

                       1 –      кальцитонин

                       2 –      кальцитриол

                       3 –      паратгормон

                       4 –      все перечисленные


 

1056.     Основной путь выделения калия из организма:

                       1 –      с желчью

                       2 –      с мочой

                       3 –      с потом

 

1057.     Гипокалиемия может быть при:

                       1 –      рвоте и поносе

                       2 –      почечной недостаточности (острой и хронической)

                       3 –      сепсисе

 

1058.     Гипохлоремия возникает при:

                       1 –      гиповентиляции

                       2 –      диабетическом кетоацидозе

                       3 –      хронической диарее

                       4 –      почечной недостаточности

                       5 –      при всех перечисленных состояниях

 

1059.     Железо в организме необходимо для:

                       1 –      транспорта кислорода

                       2 –      окислительно-восстановительных реакций

                       3 –      реакций иммунитета

                       4 –      кроветворения

                       5 –      выполнения перечисленных функций

 

1060.     Основные клинико-лабораторные признаки гемохроматоза все, кроме:

                       1 –      цирроза печени

                       2 –      пигментации кожи

                       3 –      высокой концентрации гемоглобина

                       4 –      гиперкалиемии

                       5 –      гемосидероза селезенки

 

1061.     В норме рН артериальной крови человека составляет:

                       1 –      7,05-7,15

                       2 –      7,20-7,30

                       3 –      7,35-7,45

                       4 –      7,50-7,60


 

1062.     Дыхательный ацидоз возможен при:

                       1 –      нарушении функции внешнего дыхания

                       2 –      снижении активности дыхательного центра

                       3 –      гиповентиляции

                       4 –      заболевании легких

                       5 –      все верно

 

1063.     Дыхательный алкалоз возможен при:

                       1 –      искусственной вентиляции легких

                       2 –      стимуляции дыхательного центра

                       3 –      печеночной и почечной недостаточности

                       4 –      гипервентиляции

                       5 –      все верно

 

1064.     К биологически активным веществам не относится:

                       1 –      адреналин

                       2 –      гистамин

                       3 –      брадикинин

                       4 –      протамин

                       5 –      серотонин

 

1065.     Местным действием обладает:

                       1 –      гастрин

                       2 –      инсулин

                       3 –      альдостерон

                       4 –      вазопрессин

                       5 –      глюкагон

 

1066.     При повышении уровня альдостерона наблюдается:

                       1 –      повышение натрия в сыворотке крови

                       2 –      уменьшение объема внеклеточной жидкости

                       3 –      повышение уровня калия в сыворотке крови

                       4 –      снижение уровня кальция

 

1067.     При синдроме Конна содержание ренина в крови:

                       1 –      понижается

                       2 –      повышается

                       3 –      не меняется


 

1068.     При избытке соматотропина развивается:

                       1 –      акромегалия

                       2 –      синдром Иценко-Кушинга

                       3 –      гипофизарный нанизм

                       4 –      Базедова болезнь

 

1069.     Снижение уровня катехоламинов в крови характерно для стадии гипертонической болезни:

                       1 –      I

                       2 –      II

                       3 –      III

 

1070.     При гипертонической болезни уровень креатинина в крови повышается в случаях:

                       1 –      гипертонического криза

                       2 –      левожелудочковой недостаточности

                       3 –      гипертонической энцефалопатии

                       4 –      нефроагиосклероза

 

1071.     При артериальной гипертензии анемия развивается в случаях:

                       1 –      злокачественного течения

                       2 –      развития инфаркта миокарда

                       3 –      возникновения инсульта

 

1072.     При злокачественном варианте гипертонической болезни характерно развитие:

                       1 –      перемежающейся хромоты

                       2 –      асимметрии артериального давления на руках

                       3 –      почечной недостаточности

 

1073.     Характерные изменения в крови при расслаивающей аневризме аорты:

                       1 –      лейкоцитоз

                       2 –      повышение уровня общей ЛДГ

                       3 –      снижение гемоглобина

                       4 –      все перечисленное


 

1074.     Болезнь бери-бери развивается при алиментарном недостатке витамина:

                       1 –      А

                       2 –      D

                       3 –      В1

 

1075.     Пеллагра развивается при недостатке витамина:

                       1 –      А

                       2 –      В1

                       3 –      D

                       4 –      РР

 

1076.     Ксерофтальмия возникает при алиментарной недостаточности витамина:

                       1 –      А

                       2 –      В1

                       3 –      D

 

1077.

Нормальный холестерин сыворотки | Здоровое питание

Автор: Ян Шихан Обновлено 12 декабря 2018 г.

Холестерин - это жироподобное вещество, которое циркулирует в крови. Поскольку холестерин не растворяется в крови, он должен переноситься в клетки липопротеинами. Вашему организму нужен холестерин, но поддержание холестерина в определенных пределах важно для хорошего здоровья. Высокий уровень холестерина в сыворотке повышает риск сердечных заболеваний. Уровень холестерина в сыворотке крови определят.Для получения наиболее точных результатов после 12-часового голодания берут уровень холестерина в сыворотке крови.

Общий холестерин

Общий холестерин сыворотки состоит из липопротеинов высокой плотности или холестерина ЛПВП; липопротеины низкой плотности или холестерин ЛПНП; и триглицериды. Уровни указываются в миллиграммах на децилитр крови или мг / дл. Американская кардиологическая ассоциация определяет нормальный общий холестерин как менее 200 мг / дл. Общий холестерин в сыворотке выше 200 - это «погранично высокий уровень» и повышает риск сердечных заболеваний.Уровень общего холестерина в сыворотке выше 240 считается высоким. Человек с высоким уровнем общего холестерина имеет вдвое больший риск развития сердечно-сосудистых заболеваний по сравнению с человеком, у которого общий холестерин ниже 200.

Холестерин ЛПНП

Холестерин ЛПНП часто называют плохим холестерином, потому что высокие уровни ЛПНП связаны с более высоким риском сердечных сокращений. нападение или инсульт. Когда в крови циркулирует слишком много ЛПНП, он может накапливаться на стенках артерий и образовывать бляшки - толстое твердое вещество, которое может сужать артерии.Если образуется сгусток, он может блокировать кровоток, и кровь может не попасть в сердце или мозг. Американская кардиологическая ассоциация, или AHA, определяет «оптимальный» холестерин ЛПНП как менее 100 мг / дл. Уровень холестерина ЛПНП выше 190 считается очень высоким. Ограничение насыщенных жиров, трансжиров и холестерина в вашем рационе поможет снизить уровень ЛПНП.

Холестерин ЛПВП

Холестерин ЛПВП часто называют хорошим холестерином, потому что высокие уровни, кажется, защищают от сердечного приступа. Согласно AHA, от четверти до одной трети вашего сывороточного холестерина составляет ЛПВП.Риск сердечных заболеваний высок, когда уровень ЛПВП составляет менее 40 мг / дл для мужчин и менее 50 мг / дл для женщин. Лучше всего, чтобы уровень ЛПВП составлял 60 мг / дл или более. Уменьшение количества трансжиров в вашем рационе поможет вашему организму вырабатывать больше холестерина ЛПВП. Физическая активность поможет повысить уровень ЛПВП и снизить уровень ЛПНП.

Триглицериды

Триглицериды - это тип жира в крови. Калории из пищи, которые организм не использует сразу, превращаются в триглицериды и сохраняются для дальнейшего использования.У некоторых людей избыток триглицеридов в сыворотке крови связан с сердечными заболеваниями. AHA определяет нормальный уровень триглицеридов как менее 150 мг / дл и очень высокий уровень как 500 мг / дл или более. Похудение, ограничение алкоголя, физические упражнения и здоровая диета могут снизить уровень триглицеридов. Если изменение образа жизни не помогает достичь нормального уровня холестерина в сыворотке крови, врач может назначить лекарства, снижающие уровень холестерина.

.

Двойное слепое рандомизированное плацебо-контролируемое исследование, демонстрирующее эффективность смузи с добавлением эфиров растительного станола в отношении снижения уровня холестерина в сыворотке крови среди населения Индонезии

Индонезийцы имеют высокое потребление насыщенных жиров, которые являются ключевым фактором питания, способствующим повышению концентрации холестерина в крови. Мы исследовали эффективность смузи с 2 граммами растительных станолов в виде сложных эфиров по снижению уровня холестерина для снижения общего содержания холестерина в сыворотке крови и концентрации холестерина ЛПНП у взрослых индонезийцев с гиперхолестеринемией.В двойном слепом рандомизированном плацебо-контролируемом исследовании с параллельным дизайном приняли участие 99 человек. Пятьдесят субъектов получали контрольный напиток и рекомендации по питанию, а 49 субъектов получали лечебный напиток (Nutrive Benecol®) и рекомендации по питанию. Оценка исходного уровня, среднего уровня (неделя 2) и конечного уровня (неделя 4) проводилась для клинических, антропометрических и биохимических переменных. По сравнению с контролем, коктейль с растительными станолами снизил концентрацию холестерина ЛПНП в сыворотке на 7,6% () и 9,0% () за две и четыре недели соответственно.Общий холестерин в сыворотке снизился на 5,7% (по сравнению с контролем) за две недели, и дальнейшего снижения не было обнаружено через четыре недели (5,6%). По сравнению с исходной привычной диетой, уровень холестерина ЛПНП снизился на 9,3% () и 9,8% () в группе эфиров растительного станола за две и четыре недели, соответственно. Мы пришли к выводу, что употребление смузи с добавлением эфиров растительных станолов эффективно снижает общий уровень сыворотки и холестерин ЛПНП у индонезийских субъектов с гиперхолестеринемией уже через две недели. Испытание зарегистрировано как NCT02316808.

1. Введение

Как и в других странах Азиатско-Тихоокеанского региона, распространенность сердечно-сосудистых заболеваний в Индонезии растет [1]. Данные Национального обследования домашних хозяйств Индонезии показали, что причина смерти от неинфекционных заболеваний увеличилась с 25 процентов в 1980 году до 49 процентов в 2001 году [2]. Аналогичным образом, доля смертей от сердечно-сосудистых заболеваний в 2001 г. (26%) утроилась с 1986 г. (9%) [2] и продолжает расти. Последние данные показывают, что сердечно-сосудистые заболевания уже являются ведущей причиной смерти в Индонезии, на них приходится 37% всей смертности [3].В Индонезии основными факторами риска сердечно-сосудистых заболеваний являются повышенное артериальное давление, повышенный уровень холестерина в крови и курение сигарет [1]. Распространенность повышенного (> 200 мг / дл) общего холестерина оценивается в 40% у женщин и 30% у мужчин [1]. В идеале стратегии по снижению частоты сердечно-сосудистых заболеваний должны быть нацелены на первичную профилактику, особенно с помощью диетических привычек [4]. Кроме того, здоровое питание способствует снижению заболеваемости и смертности, а также для вторичной профилактики [5].

Первоначальные маневры для управления дислипидемией должны осуществляться с помощью диетического подхода с особым упором на улучшение качества потребляемых пищевых жиров [6]. Однако терапевтические изменения образа жизни часто считаются обременительными и требуют легко применимых средств модификации диеты [7]. Следует продолжать разработку функциональных пищевых продуктов со специфическими функциональными свойствами в дополнение к нормальной питательной ценности. Растительные станолы, содержащиеся в пищевых продуктах в виде сложных эфиров, представляют собой важные функциональные пищевые вещества со свойствами снижения липидов.Обширные научные данные о свойствах сложных эфиров растительных станолов по снижению общего холестерина и холестерина ЛПНП привели к их принятию в качестве мишени для методов снижения липидов несколькими международными организациями [8].

Хотя многие исследования, демонстрирующие гиполипидемический эффект эфиров растительных станолов, были проведены на людях европеоидной расы [9], доказательства для неевропейцев, в том числе азиатов, недостаточны, и их необходимо подтвердить из-за потенциальных культурных различий - через разные пищевые привычки и обычаи.Основные индонезийцы известны как население с высоким потреблением насыщенных жиров [10, 11], ключевого компонента рациона питания для высоких концентраций общего холестерина и холестерина ЛПНП [7, 12]. Таким образом, настоящее исследование направлено на демонстрацию липидснижающего действия эфиров растительных станолов в индонезийском населении.

2. Материалы и методы
2.1. Дизайн исследования и субъекты

Это двойное слепое рандомизированное контролируемое исследование с параллельным дизайном было проведено на кафедре питания медицинского факультета Университета Индонезии.В исследовании приняли участие 99 человек (44 мужчины и 55 женщин) в возрасте от 24 до 68 лет (средний возраст 47) лет, которые соответствовали следующим критериям включения: концентрация общего холестерина ≥ 200 мг / дл и <300 мг / дл и / или LDL- Концентрация C ≥ 130 мг / дл и <240 мг / дл, готовность употреблять контрольные или смузи на основе эфиров растительных станолов по две бутылки в день сразу после еды в течение четырех недель, доступность по телефону и готовность заявить письменное информированное согласие, и согласие в соответствии с условиями защиты данных и готовность участвовать в исследовании и соблюдать условия исследования.Беременные женщины, страдающие ожирением (ИМТ> 30 кг / м 2 ), пациенты с диабетом или субъекты со случайной концентрацией глюкозы в плазме> 200 мг / дл, субъекты с гипертиреозом, метаболические, эндокринные и почечные нарушения в анамнезе, острые или хронические тяжелые заболевания, которые могут мешать оценке результатов клинического исследования (такие как СПИД, опухолевые заболевания, злокачественная гипертензия и сердечная недостаточность согласно NYHA III-IV), и субъекты, которые принимали гиполипидемические препараты или другие препараты, которые могут влиять на липид метаболизм были исключены из исследования.

Перед началом скрининга каждому субъекту разъяснили суть исследования и подписали письменное информированное согласие. Протокол исследования был одобрен Комитетом по медицинской этике медицинского факультета Университета Индонезии, Джакарта, Индонезия. Исследование соответствует положениям Хельсинкской декларации 1995 г., пересмотренной в Эдинбурге в 2000 г.

В общей сложности 156 субъектов проявили интерес к участию в исследовании. Их пригласили посетить клинику для проверки соответствия критериям.На Рисунке 1 изображен поток исследования. 99 субъектов, которые соответствовали критериям отбора при скрининге, были случайным образом распределены двойным слепым методом для получения смузи либо контрольного (), либо на основе эфира растительного станола (). Использовалась простая рандомизация. Трое испытуемых из контрольной группы и пять испытуемых из группы эфиров растительного станола прекратили исследование. Из субъектов, завершивших вмешательство, двое в контрольной группе и один в группе сложного эфира станола были исключены из статистического анализа из-за уровней триглицеридов> 400 мг / дл в одной или нескольких точках отбора проб, что позволило определить уровень холестерина ЛПНП по Фридевальду. формула неуместна [13].Всего в статистический анализ было включено 88 субъектов.


Исследование включало четыре визита в исследовательскую клинику, включая скрининговое посещение. В таблице 1 приведены общие процедуры, предпринятые для каждого субъекта на этапах скрининга (неделя -2), исходном уровне (неделя 0), срединном (неделя 2) и конечном этапе (неделя 4). Посещения клиники с интервалом в два дня до или после даты приема были допустимы.

900 30 Рекомендации по здоровому питанию

Неделя
−2 (просеивание) 0 2 4

Информировано согласие X
История болезни X
Физический осмотр X X X
Антропометрические измерения X X X
Биохимические тесты X X X X
X
Неблагоприятные события X X
Сопутствующие препараты X X
Мониторинг посредством телефонных звонков X X
Оценка соответствия X X

2.2. Клиническое обследование

Общий медицинский осмотр был проведен для получения информации о жизненно важных функциях и для выявления физических и неврологических отклонений. Кровяное давление в положении сидя измеряли с помощью сфигмоманометра по стандартной методике. Перед проведением фактического измерения испытуемые сидели не менее пяти минут. Было проведено два измерения с 5-минутным интервалом, при анализе использовалось среднее значение. Равным образом при анализе использовалось среднее значение двух измерений антропометрических показателей.Вес тела измеряли в килограммах с точностью до 0,1 кг, в легкой одежде, с помощью лучевых весов Tanita (Tanita, Япония). Рост измеряли в сантиметрах с точностью до 0,1 см в положении стоя, без носков и обуви, с использованием микрошахана. Окружность живота измеряли в сантиметрах с точностью до 0,1 см, используя гибкую неэластичную ленту (Roche, Швейцария), измерение производили в средней части между нижним краем ребра и гребнем подвздошной кости, в положении стоя, живот расслаблен, ноги вместе и вес, равномерно распределенный на обе ноги.Индекс массы тела (ИМТ) рассчитывали путем деления веса тела в кг на рост в квадратном метре.

2.3. Биохимические оценки

Образцы крови собирали утром с 7:00 до 10:00 после ночного голодания продолжительностью 12 часов, и сразу же разделяли плазму и сыворотку. Все биохимические анализы проводились в сертифицированной клинической лаборатории Prodia (аккредитация по международным стандартам работы (ISO), версия 2000: 9000 с 1999 г. и версия ISO 15189 с 2007 г., Джакарта, Индонезия).Определения были сделаны сразу после

.

% PDF-1.4 % 157 0 объект > endobj 158 0 объект > поток 2003-01-05T09: 00: 07Z2020-12-27T13: 15-08: 002020-12-27T13: 15-08: 00Apex PDFWriteruuid: f0f33868-1dd1-11b2-0a00-d40927bd7700uuid: f0f3386b-1dd1-11b2-0a00-

0000000 / pdf конечный поток endobj 1 0 obj > endobj 4 0 obj > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 8 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 12 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 16 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 20 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 24 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 28 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 32 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 37 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 41 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 45 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 49 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 53 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 57 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 61 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 65 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 69 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 73 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 77 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 81 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 85 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 89 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 93 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 97 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 101 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 105 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 109 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 113 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 117 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 121 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 125 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 129 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 133 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 137 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 141 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 145 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 149 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 153 0 объект > / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Type / Page >> endobj 234 0 объект [236 0 R] endobj 235 0 объект > поток HWn8 | Wp% ") 9 笓 83rˌ4'qH6Il5 ٬ W (* 'JO ~ g t': y} {mlguFrZ ~ _RWx ݞ vӇW%) mt & hʼn

.

Розыгрыш снижения холестерина

Пищевые волокна в продуктах питания и добавках широко рекламируются для профилактики сердечных заболеваний, поскольку они, как утверждается, снижают уровень холестерина. На самом деле, это ложь - клетчатка не только не предотвращает сердечные заболевания, но и увеличивает риск атеросклероза, сердечного приступа, внезапной остановки сердца и инсульта за счет снижения холестерина ЛПВП («хорошего») и блокирования усвоения основных питательных веществ. В докладе также уделяется внимание роли клетчатки в нарушении питания, ожирении, диабете и расстройствах пищеварения.

Введение

Привет! Меня зовут Константин Монастырский (биография). Я медицинский писатель, консультант по продуктивному питанию и эксперт в области судебного питания (предыстория). Предметом этого исследования является популярное утверждение о том, что пищевые волокна и пищевые добавки могут снизить риск сердечных заболеваний!

Это, например, коробка с хлопьями Cheerios Toasted Whole Grain Oat с миской для хлопьев в форме сердца прямо в центре и синей надписью поперек: «Овес, чтобы помочь естественному снижению холестерина!» - гласит он.

Этот злак называет себя Strong Heart - верх цинизма, учитывая его высокое содержание углеводов. Опять же, чаша в форме сердца впереди, та же непрямая реклама сзади: « Я помогаю своему сердцу стать сильнее, начиная каждое утро с Kellogg's Smart Start Strong Heart!»

Конечно, мечтай о ...

Чтобы не пропустить вечеринку, это Quaker Oatmeal Squares от дедушки овсяных хлопьев.Точно такая же сделка: сердце в центре поля и сообщение: « Oatmeal помогает снизить уровень холестерина.

Вы не едите сухие завтраки? Тогда это популярное слабительное с клетчаткой готово вас спасти: « Metamucil может снизить риск сердечных заболеваний за счет снижения уровня холестерина. », - говорится на его веб-странице [1].

И он также рекламирует себя как добавка для похудания, помощь пищеварению, профилактика диабета и средство от остеопороза ... О, боже!

На самом деле, ни одно из этих утверждений не соответствует действительности.Ни хлопья Cheerios Oat , ни Quaker Oatmeal , ни Kellogg's Smart Start , ни Metamucil не снизят уровень холестерина в достаточной степени, чтобы защитить вас от сердечных заболеваний.

На самом деле, это преднамеренная и хорошо отработанная ложь, потому что, согласно всем когда-либо проводившимся клиническим исследованиям, влияние растворимой клетчатки в овсе и псиллиуме на уровень холестерина в крови настолько незначительно, что это не может существенно снизить чьи-либо шансы заболеть. развивающиеся пороки сердца.

Наиболее объективное и репрезентативное из этих исследований было опубликовано в уважаемом журнале American Clinical Nutrition под заголовком « Эффекты пищевых волокон по снижению холестерина: метаанализ ».

В этом конкретном исследовании ученые из Медицинской школы Гарвардского университета и Гарвардской школы общественного здравоохранения проанализировали результаты 67 завершенных клинических испытаний, чтобы определить среднее влияние клетчатки из овса и псиллиума на холестерин в крови.

И вот что они пришли к выводу:

«Различные растворимые волокна снижают общий холестерин и холестерин ЛПНП на одинаковую величину. Эффект невелик в пределах практического диапазона приема. Например, 3 грамма растворимой клетчатки из овса - это 3 порции овсянки по 28 граммов каждая - могут снизить общий холестерин и холестерин ЛПНП примерно на 0,13 ммоль / дл. Увеличение количества растворимой клетчатки может внести лишь небольшой вклад в диетическую терапию по снижению холестерина ». [2]

И вот что все это означает на простом английском:

  • Для начала вам нужно съесть три полных порции овсянки, чтобы немного повлиять на уровень холестерина.Это 48 граммов чистых углеводов всего за один прием пищи или эквивалент трех полных столовых ложек сахара. Для любого, кто страдает сердечным заболеванием или диабетом, одно только потребление углеводов на завтрак - это буквально «желание смерти».

  • Затем три порции клетчатки снижают общий холестерин и холестерин ЛПНП всего на 0,13 ммоль / дл - это научное измерение, которое дает крошечные 5 миллиграммов на децилитр крови. Таким образом, если ваш общий холестерин, например, составляет 280 мг / дл, добавление клетчатки снизит его только до 275 мг / дл.Любой кардиолог скажет вам, что снижение общего холестерина на 1,7% так же полезно, как и молитва. Вообще-то, молитва, наверное, более полезна ...

    «Любой кардиолог скажет вам, что снижение общего холестерина на 1,7% так же полезно, как и молитва. На самом деле, молитва, наверное, более полезна ... »

  • Наконец, увеличивать потребление клетчатки выше трех порций нецелесообразно. Снижение холестерина за счет дополнительных волокон слишком мало, чтобы на него рассчитывать... Если это то, что вам нужно, вам понадобится рецепт ...

К этому моменту я не удивлюсь, если вы зададите мне следующий вопрос:

- Господин Монастырский, но почему эти компании продвигают клетчатку для предотвращения сердечных заболеваний, когда это абсолютно бессмысленно?

Ну, они определенно не ожидают, что вы будете изучать Американский журнал клинического питания так, как я. В сознании их менеджеров по маркетингу и продажам вы просто чмо!

Они знают - если они будут достаточно часто повторять, что клетчатка снижает уровень холестерина, в конечном итоге все, от собаки вашего дяди до вашего врача, купятся на миф о том, что клетчатка предотвращает сердечные заболевания.

Естественно следующий вопрос:

- Господин Монастырский, не может быть, что все они так ошибаются насчет волокон ... Можете ли вы это доказать?

Совершенно верно! Давайте рассмотрим факты ...

Разоблачение самозванца: диета с низким содержанием жиров снижает уровень холестерина без клетчатки ...

Любой, кто читает мелкий шрифт, знает, что клетчатка не влияет на холестерин, если она не сопровождается диетой с низким содержанием жиров и холестерина. Что не так хорошо известно - та же самая диета снижает уровень холестерина еще больше, когда удаляется клетчатка.Вот факты:

Давайте начнем с поверхностного мелкого шрифта, как на этой веб-странице: «Доказано, что клетчатка в Metamucil снижает уровень холестерина *». Затем в сноске поясняется: Только «... как часть диеты с низким содержанием насыщенных жиров и холестерина. . » [3].

Вот Cheerios Oat Cereal : «Овес снижает уровень холестерина» - и точно такая же фраза, напечатанная мелким шрифтом внизу: «... при диете с низким содержанием насыщенных жиров и холестерина».

И снова - идентичная оговорка на коробке Quaker Oatmeal Squares : «...при диете с низким содержанием насыщенных жиров и холестерина »

Эти заявления об ограничении ответственности фактически требуются Управлением по контролю за продуктами и лекарствами для сопровождения заявлений о полезности [4 (овес), 5 (псиллиум)], связанных с клетчаткой и холестерином, поскольку, по данным Американской кардиологической ассоциации,

«Добавка клетчатки, добавленная к диете с высоким содержанием насыщенных жиров и холестерина, дает сомнительные преимущества для сердечно-сосудистой системы». [6]

По иронии судьбы та же самая диета с низким содержанием жиров снижает уровень холестерина даже в большей степени без каких-либо волокон, и это главная причина, по которой Американская кардиологическая ассоциация в первую очередь продвигает продукты с низким содержанием жира.

По сути, заранее было хорошо известно, что добавление клетчатки к диете с низким содержанием жира и холестерина продемонстрирует некоторое снижение холестерина просто потому, что это то, что делают эти диеты с клетчаткой или без нее!

И это также означает, что все эти клинические испытания качества клетчатки представляют собой не что иное, как хорошо организованный фарс, оправдывающий маркетинг овсяных хлопьев и слабительных средств подорожника как функциональной пищи, способной предотвратить сердечные заболевания.

Итак, вот оно:

— Добавьте растворимую клетчатку к диете с низким содержанием жиров и холестерина, и вы получите бессмысленный 1.7% снижение холестерина;

—Или придерживайтесь той же диеты без клетчатки, и ваш холестерин снизится на шесть-семь процентов;

—Или, если вы пропустили мелкий шрифт и наслаждаетесь своей обычной диетой, дополнительная клетчатка не окажет никакого влияния на холестерин, за исключением ускорения появления сердечных заболеваний из-за всех этих дополнительных углеводов в вашей миске овсянки - полная противоположность чего вы ожидаете от добавления клетчатки в свой предположительно здоровый рацион!

Выбор непростой...

Флирт с дьяволом: диеты с низким содержанием жиров и холестерина увеличивают риск сердечных заболеваний

Как бы скептически это ни звучало, диета с низким содержанием жиров и холестерина, рекомендованная вместе с клетчаткой, на самом деле может увеличить риск сердечных заболеваний. Когда большинство испытаний клетчатки проводилось в девяностых годах, самый известный бренд диеты с низким содержанием жира и холестерина назывался Step I [7], и Американская кардиологическая ассоциация активно продвигала его с целью снижения уровня холестерина в крови.Диета Шага I содержала менее 5% насыщенных жиров, очень мало холестерина и тонну углеводов - от 40 до 50%, если быть точным.

Примечание автора: Я имею в виду содержание насыщенных жиров в диете Шага I по весу (г, 5%), в то время как AHA относится к нему по калорийности (кал, 10%). Эта тактика обычно используется сторонниками диет с низким содержанием жиров, чтобы сделать их менее строгими. Поскольку каждый грамм жира содержит 9 калорий, весовое соотношение составляет чуть меньше половины его калорийности.

Было бы не так уж важно, если бы диета Step I была просто безвредной и невкусной пищей, если бы не этот улов ... Отдел геронтологии Университета Мэриленда исследовал влияние диеты Step I на женщин с избыточным весом в постменопаузе - одной из самых высоких групп риска сердечных заболеваний. Об их выводах должным образом сообщил Журнал Американской диетической ассоциации. [8]

Как и ожидалось, диета Шага I снизила общий уровень холестерина и холестерина ЛПНП у женщин на 8% и 6% соответственно, но уровень холестерина ЛПВП снизился на целых 16%.Медицинское сообщество было недовольно. Вот что написал доктор Алан Габи в статье, озаглавленной « Проблема с диетой Американской кардиологической ассоциации» и опубликованной в высоко оцененном письме Таунсенда для врачей и пациентов:

«У женщин низкая концентрация холестерина ЛПВП является более сильным независимым предиктором риска сердечно-сосудистых заболеваний, чем повышенный общий холестерин или холестерин ЛПНП. Таким образом, женщины, которые следуют рекомендациям Американской кардиологической ассоциации по снижению уровня холестерина в сыворотке, могут фактически увеличить риск сердечных заболеваний. болезнь "[9]

Итак, вот и все: добавление клетчатки к диете с низким содержанием жиров и низким содержанием холестерина может на самом деле увеличить риск сердечных заболеваний, особенно если вы женщина, близкая к менопаузе или после нее.

Угадайте, что сделала Американская кардиологическая ассоциация в ответ на это фиаско ...

Что еще вы ожидаете - он заменил опальную диету Step I на совершенно новую Step II. Это обновление 2.0 еще больше ограничило жиры и в то же время увеличило содержание углеводов до 60%!

Поэтому я совсем не удивился, прочитав * в недавнем исследовании Гарвардской школы общественного здравоохранения [10], что « t

.

Изменения уровня оксистерина и скавенджеров в тканях сердца, вызванные высоким содержанием холестерина в диете нарушенная экспрессия белка может привести к повреждению кардиомиоцитов с последующими патологическими модификациями. Хотя окисление избыточного холестерина в оксистерин в условиях повышенного стресса идентифицировано рядом исследований, роль диеты с высоким содержанием холестерина в регулировании накопления жирных кислот и оксистерина вместе с уровнями мРНК рецепторов скавенджеров в сердце остается малоизученной.Наше исследование предоставляет подробный анализ изменений профиля жирных кислот, оксистерина и рецепторов скавенджеров и их связь с гистологическими изменениями в сердечной ткани. Мы оценили изменения состава жирных кислот методом ГХ-МС, в то время как уровни 4 β, -, 25- и 27-гидроксихолестерина и 7-кетохолестерина с помощью ЖХ-МС / МС у кроликов, получавших диету с высоким содержанием холестерина. Кроме того, ряд белков, связанных с метаболизмом липидов и экспрессией мРНК рецептора скавенджера, оценивали с помощью вестерн-блоттинга и RT-PCR.Согласно нашим результатам in vivo , диета с высоким содержанием холестерина увеличивает количество ненасыщенных жирных кислот, оксистеринов и LXR α , в дополнение к экспрессии CD36, CD68, CD204 и SR-F1, в то время как добавка α -токоферола снижает экспрессию LXR , α и SR вместе с увеличением уровней 27-гидроксихолестерина и ABCA1. Наши результаты показали, что диета с высоким содержанием холестерина модулирует белки, связанные с метаболизмом липидов, что может привести к нарушению работы сердца, а α -токоферол демонстрирует свои положительные эффекты.Мы считаем, что эта работа приведет к созданию различных теорий развития сердечных заболеваний.

1. Введение

Холестерин является ключевым компонентом в регулировании различных функций клетки, включая проницаемость и текучесть мембран, синтез стероидных гормонов и желчные кислоты. После доставки холестерина в клетку через липопротеин или рецепторы скавенджеров (SR), он может быть перенесен в (i) эндоплазматический ретикулум (ER), вызывая секвестрацию белков, связывающих регуляторные элементы стерола (SREBP), чтобы уменьшить синтез и поглощение. холестерина, (ii) плазматической мембраны, усиливающей отток холестерина (известного как обратный транспорт холестерина (RCT)) через переносчик АТФ-связывающей кассеты A1 (ABCA1), и (iii) митохондриальная стерол-27-гидроксилаза (CYP27A1), увеличивая эндогенный производство 27-гидроксихолестерина с последующей активацией Х-рецепторов печени (LXR) [1].

Повышенное производство активных форм кислорода (АФК), известное как окислительный стресс, усиливается дисбалансом между антиоксидантными системами и производством клеточных АФК. Генерация оксигенированных продуктов холестерина (оксистеринов) внутри клетки в основном производится либо в результате атак свободных радикалов, либо в результате ферментативных реакций и известна как основная реакция при повреждении тканей, опосредованном холестерином [2]. Например, в то время как неокисленный холестерин не обладает воспалительным действием, было показано, что оксистерины эндогенного происхождения усиливают воспаление при ремоделировании сосудов [3].Из оксистеринов 7-кетохолестерин является одним из основных оксистеринов, повышенное содержание которых обнаруживается в плазме у пациентов с ишемической болезнью сердца [4]. 7-Кетохолестерин также участвует в развитии атеросклероза, вызывая апоптоз [5] или ингибируя обратный транспорт холестерина [6].

Повышенные уровни оксистеринов были также указаны как регулятор транскрипции генов. LXR α и PPAR α - два фактора транскрипции, которые высоко экспрессируются в макрофагах и регулируют транскрипцию генов, регулирующих метаболизм липидов, воспаление и отток холестерина [7, 8].Связанные исследования идентифицировали LXR α как рецептор стерола, который модулирует экспрессию генов, связанных с метаболизмом липидов, в дополнение к снижению накопления холестерина за счет усиления оттока холестерина, связанного с ABCA1, после связывания 25- и 27-гидроксихолестерина [ 8–10]. Оксистерины могут также способствовать SREBP, которые снижают поглощение и синтез холестерина [11].

SR идентифицированы как члены семейства «мембраносвязанных рецепторов», которые могут специфически связываться с различными лигандами, такими как окисленные фосфолипиды / липопротеины, модифицированные липидные частицы и патогены.Основываясь на современном понимании их структуры и биологической функции, SR были классифицированы по классам A – J [12]. Из-за их разнообразия в связывании лигандов и передаче сигнала, SR идентифицируются не только при развитии атеросклероза, но также при иммунном ответе, воспалении и нейродегенеративных заболеваниях. Например, хотя связывание oxLDL с рецептором скавенджера класса B SR-B2 (CD36) активирует механизмы передачи сигналов, включая JNK, p38 MAPK и тирозинкиназу Fyn [13], рецептор скавенджера класса D SR-D1 (CD68) может распознавать лектины, селектины, и OxLDL с последующей регуляцией фагоцитоза [14, 15].

Однако конкретные механизмы метаболизма липидов и оксистерина вместе с экспрессией SR в сердечной ткани после диеты с высоким содержанием холестерина и добавок α -токоферола еще полностью не выяснены. Целью нашего исследования является изучение изменений липидного обмена и экспрессии SR на модели кроликов с гиперхолестеринемией и выяснение того, влияет ли на эти изменения добавление α -токоферола, наиболее активной формы витамина Е.Для этого было исследовано внутриклеточное накопление жирных кислот и различных оксистеринов, содержащих 4 уровня β, -, 25- и 27-гидроксихолестерин и 7-кетохолестерин, помимо SREBP1c, LXR α и PPAR α . ткань сердца. Кроме того, SR (CD36, CD68, CD204 (SR-A), SR-B1, SR-F1 и SR-G) и система РКИ (ABCA1) оценивались путем измерения экспрессии мРНК. Мы наблюдали индуцированные диетой высокие уровни холестерина ряда ненасыщенных жирных кислот, оксистеринов и LXR α , в дополнение к экспрессии CD36, CD68, CD204 и SR-F1.В этом контексте добавка α -токоферола показала свой положительный эффект, уменьшив экспрессию LXR α и SR при одновременном повышении уровней 27-гидроксихолестерина и ABCA1.

2. Методы
2.1. Животные и диета

Все экспериментальные процедуры были одобрены этическим комитетом Университета Мармара, Стамбул (номер протокола 872010). Двадцать кроликов-самцов-альбиносов (возраст 2–3 месяца) были случайным образом разделены на четыре группы, которым давали 100 г в день диеты с низким содержанием витамина Е.Первая группа получала только диету с низким содержанием α -токоферола. Вторая группа получала диету с низким содержанием α -токоферола, содержащую 2% холестерина. Третья группа получала диету с низким содержанием α -токоферола, содержащую 2% холестерина, с ежедневными внутримышечными инъекциями α -токоферола (50 мг / кг), а четвертая группа получала диету с низким содержанием α -токоферола. при ежедневных внутримышечных инъекциях α -токоферола (50 мг / кг). α Концентрация -токоферола была в соответствии с предыдущей литературой [16, 17].

После 8 недель кормления, после ночного голодания кроликов анестезировали с использованием 50 мг / кг гидрохлорида кетамина и 5 мг / кг гидрохлорида ксилазина. В крови брали определение холестерина и α -токоферола. Ткани сердца каждого животного удаляли, быстро замораживали в жидком азоте и хранили при -80 ° C для ГХ-МС, ЖХ-МС / МС, количественной ПЦР и иммуноблоттинга.

2.2. Измерение уровней холестерина и α -токоферола в сыворотке

Уровни холестерина в сыворотке определяли с использованием автоматизированного ферментативного метода с помощью модульной системы Hitachi P800 (Roche).Уровни альфа-токоферола в образцах сыворотки определяли с помощью обращенно-фазовой высокоэффективной жидкостной хроматографии (ВЭЖХ) по Ниренбергу и Нанну [18]. Вкратце, образцы растворяли в этаноле и наносили на колонку C18 (5 мкм, м, 4,6 × 250 мм). MeOH: dH 2 O (95: 5) использовали в качестве подвижной фазы, и детектирование проводили с помощью УФ-детектора (Thermo) при 294 нм. Относительные стандартные площади пиков α -токоферола были определены и сравнены с площадями пиков образцов для расчета концентрации как μ г / мл.

2.3. Измерение α -токоферола в тканях сердца

Два мл гексана добавляли в чистую пробирку со 100 мг ткани сердца и инкубировали при 70 ° C в течение 10 минут с последующей гомогенизацией с использованием гомогенизатора IKA Ultraturrax при 15000 об / мин в течение 30 секунд. Во время инкубации пробирку встряхивали каждые 5 мин. Слой гексана переносили в чистую пробирку после того, как он был отделен полем старения, опосредованного гиперхолестеринемией, при сердечных заболеваниях при 1000 × g в течение 10 мин. Добавляли еще 2 мл гексана и перемешивали в течение 5 мин с остаточным водным слоем.Пробирку снова центрифугировали. Отделенный слой гексана объединяли с предыдущим. После выпаривания в атмосфере азота этанол использовали для растворения образца и α -токоферол анализировали с помощью ЖХ-МС / МС.

ЖХ-МС / МС анализы выполняли с помощью ВЭЖХ с обращенной фазой на колонке Inertsil ODS-3 (10 см × 3 мм внутренний диаметр, 3 мкм размер частиц мкм) с использованием системы Shimadzu UPLC. Подвижная фаза была следующей: растворитель A, дистиллированная вода, содержащая 0,1% муравьиной кислоты, и растворитель B, метанол, содержащий 0.1% муравьиная кислота. Использовали постоянную скорость потока 0,5 мл / мин и профиль градиента от 80% до 100% растворителя B. Детектирование проводили с помощью масс-спектрометра Applied Biosystems Sciex API 4000 QTrap (Applied Biosystems), оборудованного источником ионизации TurboIonSpray. Данные были получены в режиме селективного мониторинга положительных множественных реакций (MRM), чередуя следующие переходы: 431,5–165,0 и 431,5–137,0.

2.4. Измерение МДА в тканях сердца

Для приготовления стандартного раствора МДА 20 мл 0.1 M HCl добавляли к 34 мкл л 1,1,3,3-тетраметоксипропана (TMP) с последующей инкубацией при 40 ° C в течение 1 часа для гидролиза TMP в MDA. Концентрацию MDA в стандартном растворе определяли путем измерения его оптической плотности при 245 нм ( ε = 13 700) и свежеприготовленном разбавлении деионизированной водой для построения калибровочной кривой.

Образцы тканей (100 мг) гомогенизировали в 0,1 М фосфатном буфере (pH 7,4) с последующим добавлением 1 М КОН и 0,02 М BHT. После этого их оставляли для инкубации при 60 ° C в течение 1 ч при непрерывном встряхивании в темноте.После подкисления концентрированной HCl до pH 2 их центрифугировали при 15000 × g в течение 5 минут при 4 ° C. Затем полученные супернатанты дериватизировали равным объемом DNPH (1,2 мМ) при 50 ° C в течение 60 мин и защищали от света. После дериватизации образец охлаждали и центрифугировали при 15000 × g в течение 7 мин при 4 ° C. Супернатант переносили в чистый флакон, фильтровали через фильтр 45 мкм, мкм, и 20 мкм л полученного раствора вводили в прибор ЖХ-МС / МС (Shimadzu UPLC, AB-Sciex 4000 QTrap) для хроматографической обработки. анализ.Относительные площади стандартных пиков MDA-DNPH были определены и сравнены с площадями пиков образцов для расчета концентрации в нг / мл.

2,5. Анализ карбонила белка в тканях сердца

После стадии электроблоттинга мембраны выдерживали в TBS (100 мМ Трис, 150 мМ NaCl, pH 7,5), содержащем 20% метанола, в течение 5 минут, промывали 2 н. HCl в течение 5 минут, инкубировали с 10 мМ раствор ДНФГ в течение 5 мин, промывали 3 × 5 мин в 2 н. HCl и промывали 5 × 5 мин в 50% метаноле. Мембрану, обработанную DNPH, блокировали 5% обезжиренным сухим молоком в TBST в течение 1 ч при комнатной температуре с последующей стадией блокирования.Заблокированную мембрану инкубировали с антителом против DNP (Sigma) в 5% обезжиренном сухом молоке / TBST в течение 1 ч при комнатной температуре при постоянном перемешивании. Промокнутую мембрану промывали 3 × 5 мин TBST и инкубировали с конъюгированным с HRP вторичным антителом с последующей стадией промывки в течение 5 × 5 мин TBST. Мембрану проявили с использованием набора для хемилюминесценции (Cell Signaling), и блоты количественно / нормализовали с β -актином с помощью денситометрии с использованием программного обеспечения Image J.

2.6. Исследование ткани сердца с помощью световой микроскопии

Образцы ткани сердца фиксировали в 10% забуференном формальдегиде в течение 4 часов, обезвоживали и дважды инкубировали в ксилоле в течение 1 часа, заливали парафином и делали срезы толщиной 5 мкм на предметных стеклах мкм.Окрашивание гематоксилин-эозином и трихромом по Массону проводили и исследовали под световой микроскопией (Leica) при 200-кратном увеличении для оценки патологических признаков.

2.7. Определение профиля жирных кислот с помощью ГХ-МС в тканях сердца

Жирные кислоты ткани сердца экстрагировали согласно методу Блая и Дайера [19]. Для определения жирнокислотного состава экстрагированной сердечной ткани жирные кислоты были преобразованы в метиловые эфиры жирных кислот (FAME) методом метанольной HCl.МЭЖК отделяли и анализировали с помощью газовой хроматографии-масс-спектрометрии (GC-MS QP2010; Shimadzu Scientific Instruments), снабженной 30-метровой капиллярной колонкой из плавленого кварца (30 м × 0,32 мм внутренний диаметр, 0,25 мкм, толщина пленки мкм; Restek ). Условия ГХ были следующими: начальная температура 130 ° C, 3 ° C мин. -1 от до 240 ° C, температуры инжектора и детектора были 250 ° C, поток через колонку составлял 3,0 мл · мин -1 , коэффициент разделения составлял 1: 100, и был использован объем впрыска 1 мкл л.Пики жирных кислот (FA) были идентифицированы с использованием стандартов FAME (смесь FAME для пищевой промышленности 37, 35077 Restek) и выражены как процент от общего количества жирных кислот. Обзор идентифицированных мононенасыщенных, полиненасыщенных и насыщенных жирных кислот приведен в дополнительной таблице 1.

2.8. Определение оксистеринов с помощью ЖХ-МС / МС в тканях сердца

Оксистерины выделяли из липидных экстрактов в соответствии с методом Блая и Дайера [19] методом твердофазной экстракции (ТФЭ) [20].После выделения оксистерины анализировали методом ЖХ-МС / МС после дериватизации пиколиновой кислотой.

Метод МС для индивидуального стандарта пиколиновая кислота-оксистерин был проанализирован в «режиме сканирования» одноквадрупольного масс-спектрометра, чтобы определить, были ли оксистерины дериватизированы до соединений и структуры фрагментации, описанные Honda et al. [21]. Хроматографическое разделение пиколинильных производных оксистеринов проводили в системе Shimadzu LC, и образцы анализировали и детектировали с помощью детектора ESI-MS / MS в положительном режиме.Использовали колонку Hypersil GOLD C18 (15 см × 2,1 мм, 3 мкм, размер частиц мкм Thermo Electron). Температуру термостата колонки поддерживали на уровне 40 ° C, а скорость потока насоса поддерживали на уровне 0,3 мл / мин. Подвижная фаза была реализована в градиенте с использованием 100% ацетонитрила с 0,1% уксусной кислоты (подвижная фаза A) в насосе A и 100% воды с 0,1% уксусной кислоты в насосе B (подвижная фаза B). Программа градиента началась с 80% подвижной фазы B в течение 2 минут и затем была увеличена до% 90 мобильной фазы B в течение 28-минутного периода и выдерживалась в течение 2 минут, а затем вернулась к исходным условиям.

Система ЖХ-МС / МС состояла из трехквадрупольного масс-спектрометра API 4000 QTrap (Applied Biosystems) через источник TurboVTM ESI и системы УФЖХ Shimadzu, в которой оксистерины 4 β -гидроксихолестерин, 7-кетохолестерин, 25-гидроксихолестерин , и 27-гидроксихолестерин.

2.9. Иммуноблот-анализ

100 мг тканей сердца гомогенизировали в буфере RIPA (Cell Signaling) с использованием гомогенизатора Ultraturrax при 15000 об / мин в течение 30 секунд и центрифугировали при 15.000 за 20 минут. Концентрации белка в супернатантах определяли методом Лоури. 30 мкМ г образцов белка разделяли с помощью гелей 10–12% SDS-PAGE и переносили на мембраны из нитроцеллюлозы или PVDF. Мембраны зондировали первичными антителами против SREBP1c и LXR α (Abcam). После использования вторичных антител, конъюгированных с HRP, и набора для хемилюминесценции (Cell Signaling) блоты были количественно определены и нормализованы с использованием β -актина путем денситометрии с использованием программного обеспечения Image J.

2.10. Анализ экспрессии генов

100 мг тканей сердца гомогенизировали и выделяли суммарные РНК с помощью набора RNA Midi Kit (QIAGEN) с последующей обратной транскрипцией с использованием набора Transcriptor High Fidelity cDNA Synthesis (ROCHE). Количественная ПЦР с обратной транскриптазой применялась к кДНК с использованием набора QuantiTect PCR Sybr Green (QIAGEN) и системы ПЦР Rotor Gene Q-RT (QIAGEN). Был определен пороговый цикл (CT), а затем была рассчитана относительная экспрессия гена следующим образом: кратное изменение = 2 - Δ (ΔCT) , где ΔCT = CT - содержание мишени CT ( β -актин) и Δ ( ΔCT) = ΔCT - CT-обработанный контроль.Последовательности праймеров, используемых для обнаружения экспрессии транскриптов кролика, перечислены в дополнительной таблице 2.

2.11. Статистический анализ

Статистический анализ выполняли с использованием программного обеспечения Prism 4 (Graph-Pad). Для определения статистической значимости различий был выполнен односторонний дисперсионный анализ с последующими множественными сравнениями с использованием критерия Стьюдента. Значение менее 0,05 было принято как статистически значимое.

3. Результаты
3.1. Уровни холестерина в сыворотке и α -токоферола

Чтобы выявить влияние диеты с 2% холестерина в течение 8 недель на метаболизм липидов и оксистерина в ткани сердца, мы создали хорошо известную модель кролика с гиперхолестеринемией. Чтобы обеспечить нашу модель гиперхолестеринемии in vivo и добавку α -токоферола, во-первых, мы измерили уровни холестерина и α -токоферола в сыворотке. Мы обнаружили примерно 40-кратное повышение уровня холестерина в сыворотке у кроликов, получавших 2% холестерина, и 10-кратное увеличение содержания α -токоферола в сыворотке при его добавлении (таблица 1), что подтверждает наши предыдущие результаты [17, 22, 23].


Уровни холестерина в сыворотке (мг / дл) Сыворотка Уровни α -токоферола ( мк г / мл)
52,0 ± 9,8 2,8 ± 1,3
Холестерин 2027,2 ± 860,4 24,5 ± 3,4
Холестерин + α -токоферол 2341,4 ± 552.5 21,1 ± 4,7
α -Токоферол 60,2 ± 23,9 17,3 ± 10,3

среднее значение. по сравнению с контрольной группой ().
3.2. Уровни альфа-токоферола и окислительный статус в тканях сердца

Чтобы определить содержание α -токоферола и статус окисления липидов и белков, мы исследовали уровни α -токоферола и MDA вместе с образованием карбонила белка с помощью LC. -MS / MS и Oxyblot соответственно.Как и ожидалось, повышенные уровни α -токоферола наблюдались в сердечных тканях холестерина + α -токоферола и α -токоферола кроликов по сравнению с контролем (Рисунок 1 (a)). Что касается окисления липидов, группа холестерина продемонстрировала увеличение уровней МДА, которые были снижены до контрольных уровней при добавлении α -токоферола (рис. 1 (b)). Кроме того, как показано на рисунке 1 (c), мы обнаружили, что диета с высоким содержанием холестерина также индуцирует образование карбонила белка по сравнению с контролем, после чего не наблюдается значительных изменений в группе холестерин + α -токоферол по сравнению с холестерином.

3.3. Исследование тканей сердца с помощью световой микроскопии

Для оценки морфологических особенностей сердца были проведены окрашивания гематоксилин-эозином (Рисунки 1 (a) –1 (d)) и трихромом Массона (Рисунки 2 (e) –2 (h)). . В то время как контрольная группа и группа α -токоферола имели нормальную морфологию миокарда (рисунки 2 (a) и 2 (d)), кролики, получавшие холестерин, имели повреждение сердечной ткани, так как увеличивалась потеря миофибрилл, которая была снижена у животных, получавших добавку α . -токоферол (Рисунки 2 (б) и 2 (в)).Кроме того, окрашенные трихромом срезы Массона, визуализированные с помощью световой микроскопии, не показали различий в уровнях фиброза между контролем (Рисунок 2 (e)), холестерина (Рисунок 2 (f)), холестерина + α -токоферола (Рисунок 2 (g). ) и α -токоферол (рис. 2 (з)) групп кроликов.

3.4. Профилирование свободных жирных кислот после диеты с 2% холестерина и добавки α -токоферола в ткани сердца

После подтверждения нашей модели in vivo мы идентифицировали изменения состава свободных жирных кислот в сердечной ткани с помощью ГХ-МС метод.Как показано на Рисунке 3 (а), ни диета с 2% холестерина, ни добавка α -токоферола не оказали существенного влияния на общие уровни насыщенных жирных кислот (НЖК) и ненасыщенных жирных кислот (НЖК). Однако, оценивая распределение различных НЖК в сердце, мы обнаружили значительное снижение уровней пальмитата (16: 0) как в группе холестерина, так и в группе α -токоферола по сравнению с контролем, при этом никакого значительного эффекта α не наблюдалось. -токоферол наблюдался у кроликов с гиперхолестеринемией (рис. 3 (б)).

Более того, в рамках распределения UFA в группе холестерина были обнаружены повышенные уровни эйкозадиеноата (20: 2n6), эйкозатриеноата (20: 3n6) и арахидоната (20: 4n6) по сравнению с контролем. Накопление олеата (18: 1n9) и α -линолената (18: 3n3) также наблюдалось в группе α -токоферола по сравнению с контролем. Интересно, что мы обнаружили, что добавка α -токоферола у кроликов, получавших холестерин, показала свой эффект за счет увеличения уровней γ -линолената (18: 3n6) в сердечной ткани (рисунок 3 (c)).

3.5. Профилирование оксистерина в сердце после диеты с высоким содержанием холестерина и добавок α -токоферола

Оксистерины возникают ферментативно путем гидроксилирования боковой цепи холестерина и неферментативно образуются в результате атаки активных форм кислорода на стероловое кольцо С-7 холестерина [24]. В условиях индуцированного воспалительного и окислительного стресса избыточные уровни свободного холестерина склонны к аутоокислению до оксистеринов, которые были определены как главный фактор риска развития сердечно-сосудистых заболеваний [25].Как показано на рисунке 4, наши результаты ЖХ-МС / МС для сердечной ткани показали, что уровни как 4 β, -, 25- и 27-гидроксихолестерина, так и 7-кетохолестерина были значительно увеличены в группе холестерина по сравнению с контролем. Уровни 27-гидроксихолестерина также продолжали значительно повышаться в группе холестерин + α -токоферол по сравнению с холестерином. Эта картина не наблюдалась в других оксистеринах, таких как 4 β -гидроксихолестерин, 25-гидроксихолестерин и 7-кетохолестерин.Кроме того, добавка α -токоферола у нормохолестеринемических кроликов показала свой эффект за счет увеличения уровней 7-кетохолестерина по сравнению с контролем.


.

Гранулы Shuangyu Tiaozhi ослабляют гиперхолестеринемию за счет снижения синтеза холестерина у крыс, которых кормили диетой с высоким содержанием холестерина. при гиперхолестеринемии в традиционной китайской медицине (ТКМ). Однако потенциальные молекулярные механизмы введения СТГ при гиперхолестеринемии остаются неизвестными.В этом исследовании мы исследовали влияние СТГ на метаболизм холестерина в печени на моделях крыс с гиперхолестеринемией, вызванной диетой с высоким содержанием холестерина (HC), и симвастатин использовался в качестве положительного контроля. Самцов крыс Sprague Dawley (SD) кормили общей диетой или диетой HC, соответственно. После 4 недель кормления крыс с гиперхолестеринемией, вызванной HC-диетой, кормили HC-диетой, STG при 5% (мас. / Мас.) Или 10% (мас. / Мас.), Смешанными с HC-диетой, или HC-диетой в сочетании с зондами симвастатина (4 мг. · Кг −1 · d −1 ) в течение 4 или 8 недель.Лечение STG уменьшало прибавку в весе, соотношение веса печени, уровни липидов в сыворотке и накопление липидов в печени у крыс, получавших диету с HC. Более того, влияние СТГ на уменьшение массы тела и снижение уровня холестерина в печени зависело от дозы и времени. Кроме того, лечение STG или симвастатином снижало уровни мРНК и белка HMGCR и SREBP-2 в печени. Экспрессия мРНК ACAT-2 и CYP7A1 была значительно снижена в диете HC, дополненной STG, в то время как уровни мРНК LDLR были заметно увеличены.STG ослабляет гиперхолестеринемию путем ингибирования активации сигнального пути SREBP-2 и увеличения экспрессии генов, поглощающих печень, обеспечивая новую идею TCM, снижающую уровень холестерина для клинического применения.

1. Введение

Гиперхолестеринемия, нарушение липидного обмена, является основным фактором риска возникновения и развития ишемической болезни сердца (ИБС) [1, 2]. В частности, высокая концентрация циркулирующего холестерина липопротеидов низкой плотности (ХС ЛПНП) часто связана с возникновением инфаркта миокарда [3].Согласно недавним исследованиям, ИБС как глобальная эпидемия неинфекционных заболеваний является ведущей причиной смерти [4], а уровень смертности от ИБС в Китае за десять лет вырос с 16% до 24% [5, 6]. Кроме того, гиперхолестеринемия также связана с аистами [7], неалкогольной жировой болезнью печени (НАЖБП) [8] и избыточным весом [9].

Источниками холестерина у млекопитающих являются биосинтез de novo из ациетил-КоА, эндоцитоз, опосредованный рецепторами LDL (LDLR) из плазмы, и абсорбция из диеты, при которой от 70% до 80% холестерина синтезируется печенью in vivo [ 10].3-гидрокси-3-метилглутарил-КоА-редуктаза (HMGCR) как ограничивающий скорость фермент, а также мишень регуляции обратной связи катализирует HMG-CoA в мевалонат, который является ключевым этапом синтеза холестерина. Более того, транскрипция гена HMGCR регулируется стерол-регуляторным элементом-связывающим белком-2 (SREBP-2), который является основным ядерным фактором транскрипции [11]. Согласно клиническим руководствам, статины, направленные на снижение синтеза холестерина, рекомендуются в качестве терапии первой линии у пациентов с ИБС, вызванной повышенным холестерином, особенно уровнями ХС-ЛПНП [12, 13].Однако даже терапия статинами средней или высокой интенсивности также позволяет 20% пациентов достичь цели лечения ХС-ЛПНП <70 мг · дл -1 [14]. При этом нельзя не учитывать стоимость терапии и побочные эффекты [15, 16]. Поэтому срочно необходимо сосредоточить внимание на поиске новых, безопасных и эффективных препаратов для снижения уровня холестерина.

Традиционная китайская медицина (ТКМ) с многоцелевым и многопрофильным подходом имеет преимущество для лечения сложных течений заболеваний [17, 18].Гранулы Shuangyu Tiaozhi (STG), состоящие из Shuyu и Bixie, получены из отвара Huazhuo Xingxue, который в клинических условиях используется для снижения уровня липидов. Наши предыдущие исследования показали, что СТГ может снижать уровень липидов в сыворотке крови у пациентов с гиперхолестеринемией [19]. В настоящем исследовании мы стремимся выяснить, влияет ли влияние различных доз и продолжительности лечения СТГ, традиционного китайского рецепта, на массу тела, липиды сыворотки и уровни холестерина в печени через регулирование пути синтеза холестерина и поглощения холестерина, опосредованного ЛПНП. крыса, получавшая диету с высоким содержанием холестерина (HC).

2. Материалы и методы
2.1. Животные

Пятьдесят 6-недельных самцов крыс Sprague Dawley (SD) массой от 160 до 180 г были приобретены у Vital River Laboratory Animal Technology Co., Ltd (Пекин, Китай). Крыс содержали при 12-часовом цикле свет / темнота при контролируемой температуре (23 ± 2 ° C) и влажности 50-60%. И всем крысам был разрешен свободный доступ к энергии и питьевой воде. Все эксперименты проводились в соответствии с Руководством по уходу и использованию лабораторных животных и одобрены Комитетом по этике Шаньдунского университета традиционной китайской медицины.

2.2. Приготовление STG

Компоненты STG включают 60 г шую (Rhizoma Dioscoreae) и 18 г бикси (Dioscoreae Spongiosae Rhizoma). А травяные концентраты-гранулы (1 г концентрата-гранулы = 20 г кусочков китайских трав) были предоставлены Jiangyin Tian Jiang Pharmaceutical Co., Ltd. (Цзянсу, Китай) и были идентифицированы профессором Фэн Ли из фармацевтического колледжа, Шаньдун. Университет традиционной китайской медицины. Для исследований in vivo STG был доставлен в Beijing Keaoxieli Feed Co., Ltd. (Пекин, Китай), чтобы добавить 5% (мас. / Мас.) Или 10% (мас. / Мас.) СТГ к диете HC, соответственно (Таблица 1).

900

Ингредиенты (%) общая диета диета с высоким содержанием холестерина
контроль HC HSTG LSTG
общее питание 100 97.7 87,7 92,7
(i) сырой белок 20 19,54 17,54 18,54
(ii) сырой липид 4,5 4,4 3,95 4,17
(iii) сырая клетчатка 3,7 3,61 3,24 3,43
(iv) сырой асб 6,53 6,38 5,73 6.05
(v) влажность 11 10,75 9,65 10,2
(vi) премикс 54,27 53,02 47,59 50,31
холестерин - 2 2 2
натрия холат - 0,3 0,3 0,3
STG - - 10 5

2.3. Индукция гиперхолестеринемии и медикаментозное лечение

После адаптации к окружающей среде в течение 1 недели все крысы получали общий рацион или диету с углеводородами (Beijing Keaoxieli Feed Co., Ltd., Пекин, Китай) в течение 4 недель. Во многих предыдущих исследованиях уровень липидов сыворотки у всех крыс повышался после того, как они получали диету с HC в течение 4 недель [20]. Все экспериментальные крысы были случайным образом разделены на 5 групп (n = 10 на группу): группа с общей диетой (контроль), группа с HC-диетой (HC), HC-диета с добавлением высоких доз STG, группа (10% (w / w) STG, HSTG), HC-диета с добавлением группы низких доз STG (5% (мас. / Мас.) STG, LSTG) и HC-диета с добавлением группы симвастатина (симвастатин).В частности, группе симвастатина вводили внутрижелудочно симвастатин (растворенный в физиологическом растворе до дозировки 4 мг · кг -1 · день -1 , Hangzhou Moshadong Pharmaceutical Co., Ltd., Ханчжоу, Китай). Вес тела крыс измеряли регулярно каждые две недели, и дозировку симвастатина корректировали в соответствии с весом крыс. После лечения СТГ или симвастатином в течение 4 или 8 недель крыс умерщвляли для сбора образцов крови и печени. Часть ткани печени фиксировали в 4% параформальдегиде для окрашивания гематоксилином и эозином (H&E) и иммуногистохимии, а оставшуюся часть замораживали в жидком азоте и затем хранили при -80 ° C до дальнейшего анализа.

2.4. Анализ сыворотки

Образцы крови были взяты из брюшной аорты. После помещения на 1 час при комнатной температуре образцы крови центрифугировали при 1500 × g в течение 10 минут для получения супернатанта. Образцы сыворотки хранили при -20 ° C, а уровни общего холестерина (TC), триглицеридов (TG), холестерина липопротеинов низкой плотности (LDL-C) и холестерина липопротеинов высокой плотности (HDL-C) измеряли с помощью автоматический биохимический анализатор в клинической лаборатории дочерней больницы Шаньдунского университета традиционной китайской медицины (Цзинань, Китай).

2,5. Анализ липидов печени

Липиды печени измеряли с использованием набора для анализа общего холестерина в тканях или набора для анализа свободного холестерина в тканях (E1015, E1016, Applygen Technologies Co., Ltd, Пекин, Китай) в соответствии с инструкциями производителя. Уровни холестерина в печени корректировали на концентрацию белка.

2.6. H&E Staining

Ткани печени заливали парафином и разрезали на 5 срезов толщиной мкм и мкм. Затем срезы, окрашенные H&E, наблюдали под световым микроскопом (Olympus BX51, Япония).

2.7. ПЦР в реальном времени

Суммарную РНК экстрагировали из тканей печени крысы с помощью реагента Trizol (Invitrogen, Thermo Fisher Scientific, США) в соответствии с инструкциями производителя. Концентрации РНК анализировали спектрофотометрически (Nanodrop 2000c, Thermo Fisher Scientific, США). Согласно инструкциям производителя, обратную транскрипцию выполняли с помощью набора 5x All-In-One RT MasterMix (Abm, Канада), а ПЦР в реальном времени проводили с использованием набора SYBR Green PCR Master Mix (DBI Bioscience, Германия) в LC480. (Рош, Мангейм, Германия).Все количественные оценки были выполнены с использованием GAPDH в качестве эндогенного контроля. Данные были проанализированы с использованием 2 методов. Каждый образец повторно тестировался трижды. Последовательности праймеров перечислены в таблице 2.

CCACAATATG CCACAATATG CCAACA 5

Ген Последовательность (5 '- 3')

HMGCR Вперед праймер CCTCCATTGAGATCCGGAGG
Обратный праймер AAGTGTCACCGTTCCCACAA
SREBP-2 Прямой праймер GGCTGTCGGGTGTCATGGG
Обратный праймер CTGTTCTCATCCATCGCCCAG
LDLR Прямой праймер TCACTGAAGCGCAAGGAGGA
Обратный праймер ATGTCACCTTGGACTTGGGA
ACAT-2 Передний праймер TATGCACGGCCCCCAATATG
CCAACA
CYP7A1 Прямой праймер CTCTAAATGCCCTGCAGATGA
Обратный праймер GGCACGGCTAATGATTCTCT
GAPDH Прямой праймер CCTCTG35 CCTCTG35
2.8. Подготовка белка и вестерн-блоттинг

Образцы ткани печени трижды промывали холодным фосфатно-солевым буфером (PBS) перед лизированием в буфере для лизиса RIPA (Beyotime Biotechnology Company, Цзянсу, Китай) с фенилметансульфонилфторидом (Beyotime Biotechnology Company, Цзянсу, Китай) на льду и центрифугировали при 4 ° C, 6000 × g в течение 20 мин. Набор для анализа белка BCA (Beyotime Biotechnology Company, Jiangsu, China) использовали для измерения концентраций белка. Вкратце, общие белки (110 мкл г) разделяли на 10% SDS-полиакриламидном геле для электрофореза и затем переносили на поливинилиденфторидную (PVDF) мембрану (0.45 μ м, Миллипор, Биллерика, Массачусетс, США). После блокирования 5% обезжиренным молоком в течение 1 часа при комнатной температуре мембрану соответственно инкубировали со следующими первичными антителами: SREBP-2 (1: 500, abcam, Burlingame, CA, USA, ab30682), HMGCR (1: 3000 , abcam, Burlingame, CA, USA, ab174830) или бета-актин (1: 5000, Proteintech Group, Inc., Ухань, Китай) в течение ночи при 4 ° C. Вторичные антитела, конъюгированные с пероксидазой хрена (1: 10000, Zhongshan Golden Bridge Biotechnology Co., Пекин, Китай), использовали для инкубации в течение одного часа при комнатной температуре.После трехкратной промывки в трис-буферном солевом растворе, содержащем 0,1% Твин 20 (TBST), иммунореактивные полосы детектировали с помощью Immobilon Western Chemiluminescent HRP Substrate (Millipore Corporation, Billerica, USA) и экспонировали с использованием системы Fluor Chem Q.

2.9. Иммуногистохимия

Иммуногистохимия выполнялась с использованием универсального двухэтапного набора для обнаружения (PV9000, Zhongshan Golden Bridge Biotechnology Co, Пекин, Китай) для обнаружения экспрессии белка SREBP-2 в соответствии с инструкциями производителя.Вкратце, срезы печени депарафинизировали, восстанавливали извлечение антигена и инкубировали с эндогенным блокатором пероксида в течение 10 минут при комнатной температуре, а затем инкубировали с первичным антителом (1: 100, abcam, Burlingame, CA, USA, ab28482) в течение ночи при 4 . C. Экспрессию белка наблюдали с помощью лазерной сканирующей микроскопии (Zeiss Vert.A1, Carl Zeiss Canada).

2.10. Статистический анализ

Данные были представлены как среднее значение ± стандартное отклонение (SD). Для сравнения статистических различий между несколькими группами использовался односторонний анализ ANOVA с последующим наименьшим значимым различием Фишера (LSD) или критерием Даннета.Статистический анализ проводили с использованием программного обеспечения SPSS 23.0 (SPSS, Inc., Чикаго, Иллинойс, США). P <0,05 считалось статистически значимым.

3. Результаты
3.1. Соотношение веса тела и веса печени

Чрезмерное накопление жира в организме связано с избыточным весом, гиперлипидемией и сердечно-сосудистыми заболеваниями головного мозга. Быстрый прирост массы тела у крыс, получавших HC-диету без добавления STG, во время процесса исследования по сравнению с контрольной группой ( P <0.01). Лечение высокими дозами СТГ в течение 2 недель, масса тела ассоциировалась со снижением по сравнению с таковыми в группе HC ( P <0,01). В то время как в группе LSTG эффект потери массы тела начал проявляться в конце 4 недель лечения низкой дозой STG по сравнению с группой HC ( P <0,05) (рисунок 1 (a)). По сравнению с контрольной группой, соотношение веса печени в группе HC увеличилось на 24,5% ( P <0,01), тогда как соотношение веса печени было снижено как при высокой, так и при низкой дозе лечения STG в течение 8 недель (рисунок 1 (b)).Внешний вид печени в группе HC был больше, чем в контрольной группе, и цвет был желтым и жирным невооруженным глазом, в то время как лечение STG в течение 8 недель смягчало эти изменения (рис. 1 (c)). Напротив, не было существенной разницы в весе тела и соотношении веса печени крыс между группой симвастатина и группой HC.

3.2. STG улучшает стеатоз печени у крыс с гиперхолестеринемией, индуцированной HC диетой

Для наблюдения гистопатологии печени образцы печени были взяты после лечения HC диеты 5%, 10% STG или симвастатина в течение 8 недель.Окрашивание H-E показало очевидное накопление липидов в гепатоцитах, заполненных небольшими вакуолями в группе HC. Среди групп HSTG, LSTG и симвастатина гепатоциты располагались регулярно, и можно было увидеть несколько жировых вакуолей (рис. 2 (а)). Соответственно, уровни TTC и FTC были значительно увеличены после кормления HC диетой в течение 4 или 8 недель по сравнению с контрольной группой, а 8 недель кормления HC диетой увеличились более значительно ( P <0,01). По сравнению с группой HC, уровни TTC были снижены при лечении высокой дозой STG в течение 8 недель ( P <0.01). Однако высокие дозы STG в течение 4 или 8 недель и низкие дозы STG в течение 8 недель были связаны со значительным снижением уровней FTC (рисунки 2 (b) и 2 (c)).

3.3. STG регулирует липиды сыворотки у крыс с гиперхолестеринемией, индуцированной HC диетой

По сравнению с контрольной группой, HC диета заметно увеличивала уровни TC, TG и LDL-C в сыворотке ( P <0,01). Как и ожидалось, группа HSTG и группа LSTG показали снижение уровней TC, TG и LDL-C по сравнению с группой HC.Крысы, получавшие HC-диету с добавлением симвастатина, имели более низкие уровни TC, TG и LDL-C, в то время как уровни только TG и LDL-C были значительно снижены по сравнению с таковыми в группе HC (Рисунки 3 (a) –3 (c)). Уровни HDL-C существенно не изменились среди HC, HSTG и LSTG, а также в группе симвастатина (рис. 3 (d)).


(а) .

Смотрите также

Колледж  |  Абитуриентам  |  Отделения  |  Отделения повышения квалификации  |  Методическая работа  |  Производственная практика  |  Студенческая жизнь  |  Библиотека  |  Опрос  |  Гостевая книга  |  Схема проезда